Homology Contig-U12870-1 vs DNA

Query= Contig-U12870-1 (Contig-U12870-1Q) /CSM_Contig/Contig-U12870-1Q.Seq.d
         (1896 letters)

Database: ddbj_A
           108,600,042 sequences; 106,710,029,556 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(BJ346257) Dictyostelium discoideum cDNA clone:dda30j10, 3' ...  1473   0.0    1
(AU060917) Dictyostelium discoideum slug cDNA, clone SLC233.     1453   0.0    1
(BJ398162) Dictyostelium discoideum cDNA clone:dds11d10, 3' ...  1382   0.0    1
(BJ372643) Dictyostelium discoideum cDNA clone:ddc13c17, 3' ...  1380   0.0    1
(BJ346414) Dictyostelium discoideum cDNA clone:dda30h19, 3' ...  1374   0.0    1
(BJ341663) Dictyostelium discoideum cDNA clone:dda7k13, 3' e...  1362   0.0    1
(BJ373492) Dictyostelium discoideum cDNA clone:ddc3f09, 3' e...  1334   0.0    1
(BJ399556) Dictyostelium discoideum cDNA clone:dds6a18, 3' e...  1328   0.0    1
(BJ376565) Dictyostelium discoideum cDNA clone:ddc29g04, 3' ...  1271   0.0    1
(BJ328993) Dictyostelium discoideum cDNA clone:dda30j10, 5' ...  1227   0.0    2
(BJ328108) Dictyostelium discoideum cDNA clone:dda23a03, 5' ...  1221   0.0    1
(BJ359930) Dictyostelium discoideum cDNA clone:ddc3f09, 5' e...  1201   0.0    2
(BJ347520) Dictyostelium discoideum cDNA clone:dda27h11, 3' ...  1185   0.0    1
(AU039727) Dictyostelium discoideum slug cDNA, clone SLG272.     1176   0.0    3
(AU034185) Dictyostelium discoideum slug cDNA, clone SLC233.     1176   0.0    1
(BJ363907) Dictyostelium discoideum cDNA clone:ddc29g04, 5' ...  1168   0.0    1
(BJ361102) Dictyostelium discoideum cDNA clone:ddc9i24, 5' e...  1162   0.0    1
(BJ388626) Dictyostelium discoideum cDNA clone:dds6a18, 5' e...  1160   0.0    1
(BJ329116) Dictyostelium discoideum cDNA clone:dda30h19, 5' ...  1154   0.0    1
(BJ373585) Dictyostelium discoideum cDNA clone:ddc3d21, 3' e...  1118   0.0    1
(BJ324717) Dictyostelium discoideum cDNA clone:dda7k13, 5' e...  1098   0.0    1
(BJ377011) Dictyostelium discoideum cDNA clone:ddc22b10, 3' ...  1090   0.0    3
(BJ359045) Dictyostelium discoideum cDNA clone:ddc12f13, 5' ...  1055   0.0    2
(BJ359240) Dictyostelium discoideum cDNA clone:ddc13c17, 5' ...   977   0.0    2
(BJ359690) Dictyostelium discoideum cDNA clone:ddc2a01, 5' e...  1049   0.0    1
(BJ373356) Dictyostelium discoideum cDNA clone:ddc2a01, 3' e...  1029   0.0    1
(BJ328182) Dictyostelium discoideum cDNA clone:dda23b07, 5' ...  1019   0.0    1
(AU061832) Dictyostelium discoideum slug cDNA, clone SLG272.      926   0.0    1
(BJ360012) Dictyostelium discoideum cDNA clone:ddc3d21, 5' e...   884   0.0    1
(BJ358478) Dictyostelium discoideum cDNA clone:ddc1a19, 5' e...   724   0.0    2
(BJ345211) Dictyostelium discoideum cDNA clone:dda23a03, 3' ...   747   0.0    1
(GR565962) CBTF1954.b1 CBTF Dictyostelium purpureum 12 hr ve...   470   0.0    4
(GR578213) CBZY1122.b1 CBZY Dictyostelium purpureum 18 hr st...   470   0.0    3
(GR570698) CBTG1402.b1 CBTG Dictyostelium purpureum 12 hr ve...   470   e-175  3
(AU061163) Dictyostelium discoideum slug cDNA, clone SLD447.      597   e-166  1
(GR584611) CCAA2559.b1 CCAA Dictyostelium purpureum 0 hr sta...   434   e-160  4
(GR566907) CBTF2684.b1 CBTF Dictyostelium purpureum 12 hr ve...   168   e-157  6
(AU033487) Dictyostelium discoideum slug cDNA, clone SLA884.      559   e-154  1
(BJ345293) Dictyostelium discoideum cDNA clone:dda23b07, 3' ...   551   e-152  1
(AU061785) Dictyostelium discoideum slug cDNA, clone SLF875.      476   e-129  1
(GR569672) CBTF620.b1 CBTF Dictyostelium purpureum 12 hr veg...   202   e-113  6
(GR584612) CCAA2559.g1 CCAA Dictyostelium purpureum 0 hr sta...   165   e-110  5
(BJ374683) Dictyostelium discoideum cDNA clone:ddc9i24, 3' e...   394   e-105  1
(GR584636) CCAA2580.b1 CCAA Dictyostelium purpureum 0 hr sta...   161   e-100  6
(GR565963) CBTF1954.g1 CBTF Dictyostelium purpureum 12 hr ve...   123   2e-97  6
(GR577759) CBXW780.b1 CBXW Dictyostelium purpureum 6 hr vege...   161   9e-95  6
(GR570699) CBTG1402.g1 CBTG Dictyostelium purpureum 12 hr ve...   165   5e-94  5
(BJ373157) Dictyostelium discoideum cDNA clone:ddc1a19, 3' e...   341   6e-89  1
(GR578214) CBZY1122.g1 CBZY Dictyostelium purpureum 18 hr st...   165   5e-83  4
(AU052704) Dictyostelium discoideum slug cDNA, clone SLD804.      295   3e-75  1
(AU061345) Dictyostelium discoideum slug cDNA, clone SLD804.      293   1e-74  1
(GR584637) CCAA2580.g1 CCAA Dictyostelium purpureum 0 hr sta...   123   7e-69  4
(AU053177) Dictyostelium discoideum slug cDNA, clone SLF875.      250   2e-61  1
(GR585006) CCAA2873.b1 CCAA Dictyostelium purpureum 0 hr sta...   161   1e-54  5
(BJ360642) Dictyostelium discoideum cDNA clone:ddc7j03, 5' e...   222   4e-53  1
(DY894977) CeleSEQ14682 Cunninghamella elegans pBluescript (...    78   5e-41  6
(U70473) Candida albicans PEP carboxykinase (PCK1) gene, com...    70   2e-40  8
(DL131137) Bax-responsive genes for drug target identificati...    70   2e-40  7
(AX536984) Sequence 585 from Patent WO02064766.                    70   2e-40  7
(AX489612) Sequence 6912 from Patent WO02053728.                   70   2e-40  7
(AR941697) Sequence 585 from patent US 7101990.                    70   2e-40  7
(AR547862) Sequence 2993 from patent US 6747137.                   70   2e-40  7
(DY893961) CeleSEQ13429 Cunninghamella elegans pBluescript (...    78   3e-40  5
(DY887482) CeleSEQ3839 Cunninghamella elegans pBluescript (E...    78   3e-40  5
(DY890575) CeleSEQ9625 Cunninghamella elegans pBluescript (E...    78   4e-40  5
(DY894706) CeleSEQ14338 Cunninghamella elegans pBluescript (...    78   6e-38  5
(DY886685) CeleSEQ2432 Cunninghamella elegans pBluescript (E...    78   9e-38  5
(DY890787) CeleSEQ7236 Cunninghamella elegans pBluescript (E...    78   2e-34  5
(DY892825) CeleSEQ11842 Cunninghamella elegans pBluescript (...    78   3e-34  5
(DY886476) CeleSEQ2146 Cunninghamella elegans pBluescript (E...    78   3e-34  4
(DY892539) CeleSEQ11096 Cunninghamella elegans pBluescript (...    78   4e-34  5
(DL131165) Bax-responsive genes for drug target identificati...    70   7e-34  7
(AX537040) Sequence 641 from Patent WO02064766.                    70   7e-34  7
(AR941725) Sequence 641 from patent US 7101990.                    70   7e-34  7
(DY890324) CeleSEQ9290 Cunninghamella elegans pBluescript (E...    70   5e-32  5
(DY891299) CeleSEQ8015 Cunninghamella elegans pBluescript (E...    78   5e-32  5
(DY891958) CeleSEQ8729 Cunninghamella elegans pBluescript (E...    78   9e-31  4
(EA397149) Sequence 45973 from patent US 7314974.                  58   4e-29  9
(DL345250) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS.       58   7e-29  8
(DJ211699) Method for identification of useful proteins deri...    58   7e-29  8
(HB223965) Sequence 82319 from Patent WO2006024951.                58   7e-29  8
(HA294077) Sequence 82319 from Patent WO2006024892.                58   7e-29  8
(DY887444) CeleSEQ3771 Cunninghamella elegans pBluescript (E...    78   2e-28  4
(DY886654) CeleSEQ2392 Cunninghamella elegans pBluescript (E...    56   2e-28  6
(DL130976) Bax-responsive genes for drug target identificati...    58   3e-28  9
(AX536662) Sequence 263 from Patent WO02064766.                    58   3e-28  9
(AR941536) Sequence 263 from patent US 7101990.                    58   3e-28  9
(AL423880) T7 end of clone AZ0AA011A11 of library AZ0AA from...    70   3e-28  7
(Z28322) S.cerevisiae chromosome XI reading frame ORF YKR097w.     58   1e-27  9
(AY723843) Saccharomyces cerevisiae clone FLH004468.01X YKR0...    58   2e-27  9
(U24234) Saccharomyces cerevisiae phosphoenolpyruvate carbox...    58   2e-27  8
(X13096) Yeast gene for phosphoenolpyruvate carboxykinase.         58   1e-25  7
(EL914955) INIT2_84_G04.g2_A006 G5 trophont cDNA (INIT2) Ich...    58   2e-25  6
(EE674442) EST1542 Mycelia Grown in Nitrogen Limited Media C...    76   5e-25  3
(L42943) Staphylococcus aureus (clone KIN50) phosphoenolpyru...    62   5e-25  6
(FJ826618) Epichloe festucae strain E2368 phosphoenolpyruvat...    50   2e-24  8
(DY893990) CeleSEQ13464 Cunninghamella elegans pBluescript (...    56   3e-24  5
(DD119735) STAPHYLOCOCCUS AUREUS PROTEINS AND NUCLEIC ACIDS.       62   4e-24  5
(CS708243) Sequence 783 from Patent EP1829892.                     62   4e-24  5
(AX617820) Sequence 783 from Patent WO02094868.                    62   4e-24  5
(U51133) Staphylococcus aureus phosphoenolpyruvate carboxyki...    62   6e-24  5
(DY886301) CeleSEQ1904 Cunninghamella elegans pBluescript (E...    66   7e-24  5
(DY888387) CeleSEQ5315 Cunninghamella elegans pBluescript (E...    62   3e-23  4
(DY890606) CeleSEQ9668 Cunninghamella elegans pBluescript (E...    56   5e-23  5
(DY886755) CeleSEQ2526 Cunninghamella elegans pBluescript (E...    56   8e-23  5
(DY888091) CeleSEQ3522 Cunninghamella elegans pBluescript (E...    58   2e-22  4
(DY886809) CeleSEQ2601 Cunninghamella elegans pBluescript (E...    58   2e-22  4
(CT744243) Paramecium tetraurelia 5-PRIME EST from clone LK0...    56   3e-22  5
(CT740857) Paramecium tetraurelia 5-PRIME EST from clone LK0...    56   5e-22  5
(DL168698) Methods for Identifying the Target of a Compound ...    62   7e-22  4
(DJ374433) Identification of Essential Genes in Prokaryotes.       62   7e-22  4
(DL171310) Methods for Identifying the Target of a Compound ...    62   7e-22  4
(DJ377045) Identification of Essential Genes in Prokaryotes.       62   7e-22  4
(AR535581) Sequence 143 from patent US 6737248.                    62   1e-21  6
(AR354025) Sequence 143 from patent US 6593114.                    62   1e-21  6
(DY891032) CeleSEQ7550 Cunninghamella elegans pBluescript (E...    56   2e-21  4
(AM678867) Entamoeba terrapinae GSS, clone terra166f03.p1k.        62   2e-21  4
(HA167050) Sequence 8224 from Patent WO2005014857.                 62   3e-21  5
(HA149690) Sequence 372 from Patent WO2005014857.                  62   3e-21  5
(CA283743) SCSBSD1058G12.g SD1 Saccharum officinarum cDNA cl...    64   1e-20  4
(EB811618) 3759_I22 Botrytis cinerea expressed sequence tags...    64   6e-20  4
(DY886059) CeleSEQ1547 Cunninghamella elegans pBluescript (E...    60   1e-19  4
(EL912332) INIT2_51_H11.b1_A006 G5 trophont cDNA (INIT2) Ich...    58   1e-19  5
(DY894056) CeleSEQ13547 Cunninghamella elegans pBluescript (...    66   2e-19  4
(DY894165) CeleSEQ13676 Cunninghamella elegans pBluescript (...    54   4e-19  6
(FE233884) CAPG2521.rev CAPG Naegleria gruberi amoeba stage ...    52   5e-19  3
(FE236144) CAPG3738.rev CAPG Naegleria gruberi amoeba stage ...    52   5e-19  3
(FE243661) CAPG7764.rev CAPG Naegleria gruberi amoeba stage ...    52   5e-19  3
(FE231297) CAPG10355.rev CAPG Naegleria gruberi amoeba stage...    52   5e-19  3
(AL419513) T7 end of clone XAX0AA001A05 of library XAX0AA fr...    62   6e-19  4
(CR382137) Debaryomyces hansenii strain CBS767 chromosome E ...    62   3e-18  17
(DL266020) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS.       58   5e-18  7
(DJ132469) Method for identification of useful proteins deri...    58   5e-18  7
(HB144735) Sequence 3089 from Patent WO2006024951.                 58   5e-18  7
(HA141388) Sequence 3089 from Patent WO2006024892.                 58   5e-18  7
(FE233885) CAPG2521.fwd CAPG Naegleria gruberi amoeba stage ...    50   7e-18  5
(EK316620) 1095462415374 Global-Ocean-Sampling_GS-31-01-01-1...    52   9e-18  5
(DY894064) CeleSEQ13555 Cunninghamella elegans pBluescript (...    56   6e-17  4
(AF157622) Plasmodium falciparum phosphoenolpyruvate carboxy...    44   8e-17  7
(FM992695) Candida dubliniensis CD36 chromosome R, complete ...    62   1e-16  17
(EB802386) 3466_L23 Botrytis cinerea expressed sequence tags...    64   2e-16  3
(EB802201) 3466_E04 Botrytis cinerea expressed sequence tags...    64   2e-16  3
(EK043002) 1092959532543 Global-Ocean-Sampling_GS-31-01-01-1...    52   4e-16  3
(EL915267) INIT2_88_F08.g1_A006 G5 trophont cDNA (INIT2) Ich...    58   2e-15  4
(CP000703) Staphylococcus aureus subsp. aureus JH9, complete...    62   4e-15  3
(CP000736) Staphylococcus aureus subsp. aureus JH1, complete...    62   4e-15  3
(AP009324) Staphylococcus aureus subsp. aureus Mu3 DNA, comp...    62   4e-15  3
(AP009351) Staphylococcus aureus subsp. aureus str. Newman D...    62   4e-15  3
(BA000017) Staphylococcus aureus subsp. aureus Mu50 DNA, com...    62   4e-15  3
(CP000730) Staphylococcus aureus subsp. aureus USA300_TCH151...    62   4e-15  3
(CP000255) Staphylococcus aureus subsp. aureus USA300_FPR375...    62   4e-15  3
(CP000253) Staphylococcus aureus subsp. aureus NCTC 8325, co...    62   4e-15  3
(BA000018) Staphylococcus aureus subsp. aureus N315 DNA, com...    62   4e-15  3
(CP000046) Staphylococcus aureus subsp. aureus COL, complete...    62   4e-15  3
(BA000033) Staphylococcus aureus subsp. aureus MW2 DNA, comp...    62   1e-14  3
(BX571857) Staphylococcus aureus strain MSSA476, complete ge...    62   1e-14  3
(AJ938182) Staphylococcus aureus RF122 complete genome.            62   1e-14  3
(EJ194877) 1092344227766 Global-Ocean-Sampling_GS-27-01-01-1...    40   1e-14  5
(FE268953) CAZO940.fwd CAZO Naegleria gruberi Flagellate Sta...    52   7e-14  3
(CT767645) Paramecium tetraurelia 5-PRIME EST from clone LK0...    56   2e-13  4
(DN451698) EST947497 Sequencing ESTs from loblolly pine embr...    58   2e-13  4
(DY891526) CeleSEQ10245 Cunninghamella elegans pBluescript (...    56   2e-13  4
(U88575) Kluyveromyces lactis phosphoenolpyruvate carboxykin...    58   3e-13  5
(CT776872) Paramecium tetraurelia 5-PRIME EST from clone LK0...    52   3e-13  5
(EK514526) 1095515492656 Global-Ocean-Sampling_GS-32-01-01-1...    44   3e-13  5
(DY886469) CeleSEQ2135 Cunninghamella elegans pBluescript (E...    44   6e-13  4
(EK276264) 1095462278552 Global-Ocean-Sampling_GS-31-01-01-1...    46   7e-13  4
(BX571856) Staphylococcus aureus subsp. aureus strain MRSA25...    62   8e-13  3
(CN596025) TTE00007045 Normalized large Tetrahymena thermoph...    58   8e-13  5
(EK313490) 1095462405226 Global-Ocean-Sampling_GS-31-01-01-1...    52   2e-12  4
(DY887146) CeleSEQ3050 Cunninghamella elegans pBluescript (E...    56   3e-12  3
(EK132120) 1093010129304 Global-Ocean-Sampling_GS-31-01-01-1...    40   3e-12  5
(ER460161) 1092963888806 Global-Ocean-Sampling_GS-35-01-01-1...    40   5e-12  5
(BB975623) Plasmodium berghei str. ANKA cDNA clone: OK005461...    56   5e-12  3
(DW138000) CLSY5433.b1_A15.ab1 CLS(XYZ) lettuce sativa Lactu...    72   6e-12  2
(DY960537) CLSM10876.b1_H07.ab1 CLS(LMS) lettuce sativa Lact...    72   7e-12  2
(DY895286) CeleSEQ15077 Cunninghamella elegans pBluescript (...    62   9e-12  3
(DY894968) CeleSEQ14668 Cunninghamella elegans pBluescript (...    62   1e-11  3
(CP000851) Shewanella pealeana ATCC 700345, complete genome.       52   1e-11  3
(DY893067) CeleSEQ12238 Cunninghamella elegans pBluescript (...    62   1e-11  3
(DY892342) CeleSEQ10538 Cunninghamella elegans pBluescript (...    62   1e-11  3
(DY894507) CeleSEQ14092 Cunninghamella elegans pBluescript (...    62   1e-11  3
(DY894786) CeleSEQ14444 Cunninghamella elegans pBluescript (...    62   1e-11  3
(EC761509) PSE00004847 rw_mgpallid Polysphondylium pallidum ...    68   1e-11  2
(GR304793) WRIS_5521 cDNA library of a compatible interactio...    44   2e-11  4
(ER401166) 1095351005512 Global-Ocean-Sampling_GS-34-01-01-1...    54   2e-11  4
(DW126628) CLSX3171.b1_F01.ab1 CLS(XYZ) lettuce sativa Lactu...    70   2e-11  2
(DY887378) CeleSEQ3350 Cunninghamella elegans pBluescript (E...    44   3e-11  4
(DB650783) Saccharomyces cerevisiae mRNA, clone: S03052-79_E...    58   4e-11  5
(GP280034) Sequence 12214 from patent US 7504493.                  58   5e-11  12
(DJ025879) Genome-wide DNA marker of Saccharomyces cerevisiae.     58   5e-11  12
(DU779801) ASXB2889.b2 HF500_10-06-02 uncultured marine micr...    46   5e-11  3
(DT375051) Conidia_7-B12.g Aerial conidia Cordyceps bassiana...    50   6e-11  3
(DT373008) Chitin_4-D06.e Chitin-grown Cordyceps bassiana cD...    50   7e-11  3
(DY964251) CLSM14808.b1_O06.ab1 CLS(LMS) lettuce sativa Lact...    68   9e-11  2
(CN593810) TTE00009341 Normalized large Tetrahymena thermoph...    58   1e-10  4
(CP000764) Bacillus cereus subsp. cytotoxis NVH 391-98, comp...    60   1e-10  2
(GM729519) Sequence 6182 from Patent WO2008048614.                 42   2e-10  6
(GM725302) Sequence 1965 from Patent WO2008048614.                 42   2e-10  6
(DT376604) Oosporein_11-D03.e Oosporein-producing Cordyceps ...    46   3e-10  3
(CT769068) Paramecium tetraurelia 5-PRIME EST from clone LK0...    52   3e-10  3
(BZ298839) CG4612.r1 Candida glabrata Random Genomic Library...    48   5e-10  4
(AY007226) Lycopersicon esculentum phosphoenolpyruvate carbo...    40   6e-10  6
(FC874138) C31202G07EF BiotPhyR1 Citrus aurantium cDNA clone...    42   8e-10  4
(CF686562) CCAH834TF C.neoformans strain JEC21 Cryptococcus ...    52   1e-09  4
(CX071999) UCRCS08_25D11_g Parent Washington Navel Orange Ca...    42   1e-09  4
(DT625185) EST1159460 Sequencing ESTs from loblolly pine emb...    58   1e-09  3
(CF684964) CCAI253TF C.neoformans strain JEC21 Cryptococcus ...    52   1e-09  4
(FE243662) CAPG7764.fwd CAPG Naegleria gruberi amoeba stage ...    48   1e-09  4
(FE236145) CAPG3738.fwd CAPG Naegleria gruberi amoeba stage ...    48   1e-09  4
(CF698894) CCAFP36TO C.neoformans strain JEC21 Cryptococcus ...    52   1e-09  4
(DW135383) CLSY2899.b1_E06.ab1 CLS(XYZ) lettuce sativa Lactu...    56   1e-09  2
(EF038416) Synthetic construct Bacillus anthracis clone FLH2...    52   1e-09  5
(ER431070) 1092963778090 Global-Ocean-Sampling_GS-35-01-01-1...    40   1e-09  4
(CT776879) Paramecium tetraurelia 5-PRIME EST from clone LK0...    52   2e-09  4
(CF714093) CCAA119TF C.neoformans strain JEC21 Cryptococcus ...    52   2e-09  4
(CQ447655) Sequence 13415 from Patent WO0192523.                   54   2e-09  3
(EY834374) PT11-C2-301-010-C03-CT.F Poncirus trifoliata bark...    42   2e-09  4
(CN594744) TTE00011461 Normalized large Tetrahymena thermoph...    38   2e-09  5
(CP000497) Pichia stipitis CBS 6054 chromosome 3, complete s...    64   2e-09  2
(CF397493) RTDS3_3_F06.g1_A022 Drought-stressed loblolly pin...    58   2e-09  3
(CT814648) Paramecium tetraurelia 5-PRIME EST from clone LK0...    52   2e-09  4
(CF676313) CCAEE61TO C.neoformans strain JEC21 Cryptococcus ...    52   2e-09  4
(CK268981) EST715059 potato abiotic stress cDNA library Sola...    40   3e-09  5
(CT749430) Paramecium tetraurelia 5-PRIME EST from clone LK0...    42   3e-09  5
(EK088835) 1092961191458 Global-Ocean-Sampling_GS-31-01-01-1...    46   3e-09  3
(CN589247) TTE00004638 Normalized large Tetrahymena thermoph...    44   3e-09  4
(DV126232) CV03044B1F02.f1 CV03-normalized library Euphorbia...    40   3e-09  4
(DY890337) CeleSEQ9314 Cunninghamella elegans pBluescript (E...    36   4e-09  6
(EH683515) CCIL8203.b1_F11.ab1 CCI(LMS) chicory Cichorium in...    58   4e-09  2
(EH672834) CCIL10467.b1_F01.ab1 CCI(LMS) chicory Cichorium i...    58   5e-09  2
(CX070354) UCRCS08_16C10_g Parent Washington Navel Orange Ca...    42   5e-09  4
(CP000447) Shewanella frigidimarina NCIMB 400, complete genome.    62   6e-09  2
(DB647327) Saccharomyces cerevisiae mRNA, clone: S03052-48_I...    50   7e-09  5
(CT766910) Paramecium tetraurelia 5-PRIME EST from clone LK0...    52   7e-09  4
(L31899) Cucumber phosphoenolpyruvate carboxykinase (pck) ge...    52   7e-09  4
(FE268952) CAZO940.rev CAZO Naegleria gruberi Flagellate Sta...    52   8e-09  2
(GR569673) CBTF620.g1 CBTF Dictyostelium purpureum 12 hr veg...    66   9e-09  2
(CT788689) Paramecium tetraurelia 5-PRIME EST from clone LK0...    40   1e-08  5
(GP248072) Sequence 2408 from patent US 7504490.                   46   1e-08  4
(DY992547) GpanSEQ10803 Geomyces pannorum pBluescript (EcoRI...    56   2e-08  5
(DY989257) GpanSEQ6589 Geomyces pannorum pBluescript (EcoRI-...    56   2e-08  5
(DV438896) davisf0006K01 Fragaria vesca 'Yellow Wonder' flow...    44   2e-08  4
(EA391267) Sequence 40091 from patent US 7314974.                  62   2e-08  2
(GR582814) CBZZ979.g1 CBZZ Dictyostelium purpureum 18 hr sta...    74   2e-08  1
(GR385259) CCBI4277.b1 CCBI Cryphonectria parasitica pool of...    50   3e-08  3
(EK039101) 1092959497953 Global-Ocean-Sampling_GS-31-01-01-1...    50   4e-08  3
(EK032611) 1092956085341 Global-Ocean-Sampling_GS-31-01-01-1...    50   4e-08  3
(CB894009) EST646801 HOGA Medicago truncatula cDNA clone HOG...    46   4e-08  5
(EE009113) ROE00005343 Rhizopus oryzae Company Rhizopus oryz...    46   4e-08  4
(CF678240) CCAHW90TF C.neoformans strain JEC21 Cryptococcus ...    46   5e-08  4
(DR708400) Asn_09257 Aspergillus niger pBluescript (EcoRI-Xh...    46   6e-08  4
(CT751645) Paramecium tetraurelia 5-PRIME EST from clone LK0...    40   7e-08  4
(CT789149) Paramecium tetraurelia 5-PRIME EST from clone LK0...    40   7e-08  4
(AM270225) Aspergillus niger contig An11c0080, complete genome.    46   8e-08  6
(DR708407) Asn_09266 Aspergillus niger pBluescript (EcoRI-Xh...    46   8e-08  4
(CP001186) Bacillus cereus G9842, complete genome.                 50   9e-08  2
(DW166734) CLVY5195.b1_E04.ab1 CLV(XYZ) lettuce virosa Lactu...    72   9e-08  1
(DW133842) CLSY1319.b1_N17.ab1 CLS(XYZ) lettuce sativa Lactu...    72   9e-08  1
(DW116317) CLRY4419.b1_E02.ab1 CLR(XYZ) lettuce serriola Lac...    72   9e-08  1
(DW114442) CLRY2558.b1_K16.ab1 CLR(XYZ) lettuce serriola Lac...    72   9e-08  1
(DW113344) CLRY1437.b1_I24.ab1 CLR(XYZ) lettuce serriola Lac...    72   9e-08  1
(DW052220) CLLX4933.b1_J10.ab1 CLL(XYZ) lettuce saligna Lact...    72   9e-08  1
(BU004613) QGG5L07.yg.ab1 QG_EFGHJ lettuce serriola Lactuca ...    72   9e-08  1
(FN005531) Petunia axillaris subsp. axillaris EST, clone dr0...    50   1e-07  4
(DR638515) EST1029140 FvM Gibberella moniliformis cDNA clone...    48   1e-07  3
(DR701449) Asn_00921 Aspergillus niger pBluescript (EcoRI-Xh...    46   1e-07  4
(DR701498) Asn_00978 Aspergillus niger pBluescript (EcoRI-Xh...    46   1e-07  4
(EY865488) CM30-C1-401-083-B06-CT.F Sweet lime leaf, infecte...    42   1e-07  3
(EA387302) Sequence 36126 from patent US 7314974.                  48   1e-07  4
(EY244046) CATY4062.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY253929) CATY9453.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY253020) CATY8964.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY244225) CATY4152.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY244978) CATY4517.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY251439) CATY8078.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY253002) CATY8955.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EK178091) 1095458107290 Global-Ocean-Sampling_GS-31-01-01-1...    38   2e-07  4
(EY252965) CATY8935.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY250124) CATY7383.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY242573) CATY3281.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY238657) CATY1178.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(EY251334) CATY8019.fwd CATY Aspergillus niger fungal filame...    46   2e-07  4
(AF481231) Cucumis sativus PEPCK (Pepck) gene, complete cds.       52   2e-07  4
(DU794825) APKH5651.g2 HF770_12-21-03 uncultured marine micr...    40   3e-07  5
(CV649992) C08_01nc_plate_2as 01nc Neotyphodium coenophialum...    50   3e-07  3
(CU928174) Zygosaccharomyces rouxii strain CBS732 chromosome...    50   3e-07  2
(DV759290) PchrSEQ8374 Phanerochaete chrysosporium pBluescri...    46   3e-07  3
(FL864493) CCGI8457.b1 CCGI Panicum virgatum etiolated seedl...    48   4e-07  3
(EY243759) CATY3920.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY238861) CATY1285.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY250557) CATY7598.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY242869) CATY3438.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY250247) CATY7445.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY243439) CATY3753.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY247429) CATY6052.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY252121) CATY8437.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(EY243537) CATY3804.fwd CATY Aspergillus niger fungal filame...    46   4e-07  2
(DR701556) Asn_01042 Aspergillus niger pBluescript (EcoRI-Xh...    46   4e-07  2
(DR709199) Asn_10599 Aspergillus niger pBluescript (EcoRI-Xh...    46   4e-07  2
(BE436435) EST407513 tomato breaker fruit, TIGR Solanum lyco...    40   5e-07  4
(CT813344) Paramecium tetraurelia 5-PRIME EST from clone LK0...    40   5e-07  4
(GR531330) CCIA7866.b1 CCIA Mucor circinelloides from light ...    44   5e-07  3
(EJ768590) 1092963348874 Global-Ocean-Sampling_GS-30-02-01-1...    40   6e-07  3
(BQ622043) fch1c.pk003.p24 Conidiobolus cornatus ARSEF 512 C...    54   6e-07  2
(AW736528) EST332542 KV3 Medicago truncatula cDNA clone pKV3...    54   6e-07  3
(EK116881) 1092963256161 Global-Ocean-Sampling_GS-31-01-01-1...    40   8e-07  4
(EY726325) CS00-C3-703-089-C05-CT.F Sweet orange fruit, deve...    42   8e-07  4
(CV291038) aof01-15ms3-c12 Aof01 Asparagus officinalis cDNA ...    40   9e-07  4
(EY721156) CS00-C3-703-019-B05-CT.F Sweet orange fruit, deve...    42   9e-07  4
(EY759998) CR05-C1-100-022-D01-CT.F Mandarin leaf, greenhous...    42   9e-07  4
(BM396358) 5009-0-2-H01.t.1 Chilcoat/Turkewitz cDNA (large f...    50   1e-06  4
(EY656038) CS00-C1-100-115-B04-CT.F Sweet orange leaf, green...    42   1e-06  4
(CV886706) UCRCS04_2_024G03_T7 Ruby Orange Developing Flower...    42   1e-06  4
(CT768759) Paramecium tetraurelia 5-PRIME EST from clone LK0...    40   1e-06  4
(BM396769) 5009-0-25-A07.t.1 Chilcoat/Turkewitz cDNA (large ...    58   1e-06  3
(CN591710) TTE00014708 Normalized large Tetrahymena thermoph...    58   1e-06  3
(CP000931) Shewanella halifaxensis HAW-EB4, complete genome.       52   1e-06  2
(EY247735) CATY6209.fwd CATY Aspergillus niger fungal filame...    46   1e-06  3
(GE213384) 253 'BH' (somaclonal variated plants of Skaggs Bo...    42   1e-06  4
(EY890124) TS27-C2-300-072-G07-CT.F Sunki mandarin bark, gre...    42   1e-06  4
(EY860245) CM30-C1-401-004-H01-CT.F Sweet lime leaf, infecte...    42   1e-06  4
(EY674265) CS00-C1-102-020-F04-CT.F Sweet orange leaf, infec...    42   1e-06  4
(AP004576) Lotus japonicus genomic DNA, chromosome 2, clone:...    54   1e-06  2
(AP004577) Lotus japonicus genomic DNA, chromosome 2, clone:...    54   1e-06  2
(EU016665) Uncultured Group I marine crenarchaea HF4000APKG1...    50   1e-06  2
(BU008446) QGH7J22.yg.ab1 QG_EFGHJ lettuce serriola Lactuca ...    68   1e-06  1
(BU003946) QGG36P13.yg.ab1 QG_EFGHJ lettuce serriola Lactuca...    68   1e-06  1
(ER369355) 1093022165823 Global-Ocean-Sampling_GS-34-01-01-1...    48   2e-06  2
(FG524909) 030522KASB001149HT (KASB) Subtractive library usi...    54   2e-06  2
(FG400833) 010723KHFA004639HT (KHFA) A. arguta ripe fruit Ac...    54   2e-06  2
(AV421951) Lotus japonicus cDNA clone:MWM002e06_r, 5' end.         54   2e-06  2
(AM466633) Vitis vinifera, whole genome shotgun sequence, co...    38   2e-06  3
(DC900116) Citrus sinensis mRNA, clone: VS27V30, 5'-end sequ...    42   2e-06  4
(EC977118) WIN1033.C21_K04 Muscat Hamburg post-veraison peri...    38   2e-06  3
(DV756692) PchrSEQ5365 Phanerochaete chrysosporium pBluescri...    42   2e-06  4
(EC920149) WIN013.BR_G03 Cab Sauv pericarp non-normalized (W...    38   2e-06  3
(EE090328) S6B06493 Fruits 7-9 mm (VvS6) Vitis vinifera cDNA...    38   2e-06  3
(EE094731) S8B01093 Fruits Veraison (VvS8) Vitis vinifera cD...    38   2e-06  3
(EE095758) S8B02893 Fruits Veraison (VvS8) Vitis vinifera cD...    38   2e-06  3
(DT031816) VVL062B08_685258 CabSau Berry Postveraison Mixed ...    38   2e-06  3
(DT028834) VVL027F09_679294 CabSau Berry Postveraison Mixed ...    38   2e-06  3
(DT029431) VVL034E01_680488 CabSau Berry Postveraison Mixed ...    38   2e-06  3
(CF603993) BACCA01_001312 Grape Berry pSPORT1 Library Vitis ...    38   2e-06  3
(FD682274) CBHX2073.rev CBHX Mycosphaerella fijiensis MfEST4...    44   2e-06  4
(FG984952) aB2_B03_R Grape berry-specific cDNA library Vitis...    38   2e-06  3
(FG984779) aB2_B03_F Grape berry-specific cDNA library Vitis...    38   2e-06  3
(EE001633) ROE00013193 Rhizopus oryzae Company Rhizopus oryz...    46   2e-06  3
(FD682362) CBHX2119.fwd CBHX Mycosphaerella fijiensis MfEST4...    44   2e-06  4
(FD684479) CBHX4721.fwd CBHX Mycosphaerella fijiensis MfEST4...    44   2e-06  4
(FD674785) CBHU3556.fwd CBHU Mycosphaerella fijiensis MfEST3...    44   2e-06  4
(FD669430) CBHT3967.fwd CBHT Mycosphaerella fijiensis MfEST3...    44   2e-06  4
(FD672310) CBHU2176.fwd CBHU Mycosphaerella fijiensis MfEST3...    44   2e-06  4
(BB975602) Plasmodium berghei str. ANKA cDNA clone: OK005439...    56   3e-06  2
(BQ785985) saq62a12.y1 Gm-c1076 Glycine max cDNA clone SOYBE...    44   3e-06  3
(DB646070) Saccharomyces cerevisiae mRNA, clone: S03052-42_C...    40   3e-06  5
(BB981818) Plasmodium berghei str. ANKA cDNA clone: OK012128...    56   3e-06  2
(EE008095) ROE00003741 Rhizopus oryzae Company Rhizopus oryz...    46   3e-06  3
(DV757892) PchrSEQ7025 Phanerochaete chrysosporium pBluescri...    42   4e-06  4
(EJ100913) 1095469436042 Global-Ocean-Sampling_GS-26-01-01-1...    48   4e-06  2
(GR829200) CCCC3957.b1 CCCC Glycine max callus grown in dark...    44   5e-06  3
(CP000866) Nitrosopumilus maritimus SCM1, complete genome.         44   5e-06  2
(CF504605) USDA-FP_120000-094 Immature Ovaries from field-co...    42   5e-06  3
(DW146614) CLVX11726.b1_K04.ab1 CLV(XYZ) lettuce virosa Lact...    46   6e-06  3
(AW033260) EST276831 tomato callus, TAMU Solanum lycopersicu...    40   6e-06  4
(AR538477) Sequence 3039 from patent US 6737248.                   52   6e-06  2
(AR356921) Sequence 3039 from patent US 6593114.                   52   6e-06  2
(AW774795) EST333946 KV3 Medicago truncatula cDNA clone pKV3...    46   7e-06  4
(FD666723) CBHT1492.fwd CBHT Mycosphaerella fijiensis MfEST3...    44   7e-06  4
(EA375359) Sequence 24182 from patent US 7314974.                  34   7e-06  3
(FD669536) CBHT4020.fwd CBHT Mycosphaerella fijiensis MfEST3...    44   8e-06  4
(EY429681) ZY008488 Aspergillus oryzae EST Library Aspergill...    36   8e-06  4
(GR236207) CCOI5346.b1 CCOI Tremella mesenterica jelly fungu...    36   9e-06  4
(CF682848) CCACD39TF C.neoformans strain JEC21 Cryptococcus ...    38   1e-05  4
(EL908538) INIT2_25_D09.g1_A006 G5 trophont cDNA (INIT2) Ich...    40   1e-05  3
(CT783616) Paramecium tetraurelia 5-PRIME EST from clone LK0...    58   1e-05  3
(AX145619) Sequence 4341 from Patent WO0134809.                    50   1e-05  3
(AR486255) Sequence 4341 from patent US 6703492.                   50   1e-05  3
(AF270301) Staphylococcus epidermidis strain SR1 clone step....    50   1e-05  3
(BM396359) 5009-0-2-H01.t.2 Chilcoat/Turkewitz cDNA (large f...    36   2e-05  5
(CP001632) Capnocytophaga ochracea DSM 7271, complete genome.      34   2e-05  3
(CU856536) S.lycopersicum DNA sequence from clone SL_FOS-2F2...    40   2e-05  7
(DY889490) CeleSEQ11360 Cunninghamella elegans pBluescript (...    42   2e-05  3
(DV759039) PchrSEQ10026 Phanerochaete chrysosporium pBluescr...    42   2e-05  3
(CA581039) EST000714 Mycelium and yeast cells from Paracocci...    42   2e-05  4
(AR944917) Sequence 20 from patent US 7105723.                     40   2e-05  5
(BU006370) QGH10N17.yg.ab1 QG_EFGHJ lettuce serriola Lactuca...    64   2e-05  1
(GR582748) CBZZ928.g1 CBZZ Dictyostelium purpureum 18 hr sta...    64   2e-05  1
(EY712639) CS00-C3-702-021-G04-CT.F Sweet orange fruit, deve...    42   2e-05  3
(DY822115) CTOY13921.b1_B01.ab1 CTO(XYZ) dandelion Taraxacum...    44   2e-05  2
(DY822149) CTOY13953.b1_B09.ab1 CTO(XYZ) dandelion Taraxacum...    44   2e-05  2
(DY821657) CTOY13495.b1_M13.ab1 CTO(XYZ) dandelion Taraxacum...    44   2e-05  2
(DY821808) CTOY13634.b1_C02.ab1 CTO(XYZ) dandelion Taraxacum...    44   2e-05  2
(CX544241) UCRPT01_5_012_B06_T7 Poncirus trifoliata CTV-chal...    42   2e-05  3
(AL388327) Medicago truncatula EST MtBC47H10F1 : T3 end of c...    38   3e-05  4
(EA074831) Sequence 2189 from patent US 7183083.                   50   3e-05  2
(GC558541) Sequence 2252 from patent US 7416862.                   50   3e-05  2
(AR888528) Sequence 2189 from patent US 7060458.                   50   3e-05  2
(CR380954) Candida glabrata strain CBS138 chromosome H compl...    48   3e-05  16
(FG475545) 020217KALA006670HT (KALA) Dormant kiwifruit buds ...    44   3e-05  3
(AR944916) Sequence 19 from patent US 7105723.                     40   3e-05  5
(GD283779) b1p15a8.r1 Cryptococcus neoformans strain 184A, g...    44   3e-05  4
(DY991712) GpanSEQ9589 Geomyces pannorum pBluescript (EcoRI-...    56   4e-05  3
(FG478580) 021009KALA009484HT (KALA) Dormant kiwifruit buds ...    44   4e-05  3
(AB226268) Aspergillus oryzae cDNA, contig sequence: AoEST3128.    36   4e-05  4
(CT786995) Paramecium tetraurelia 5-PRIME EST from clone LK0...    36   5e-05  4
(EJ464345) 1095388024768 Global-Ocean-Sampling_GS-28-01-01-1...    40   5e-05  4
(DN829625) KUCD01_11_D06_T3 WSWR cDNA library Triticum aesti...    38   6e-05  4
(DY891240) CeleSEQ7932 Cunninghamella elegans pBluescript (E...    46   6e-05  2
(AE009951) Fusobacterium nucleatum subsp. nucleatum ATCC 255...    40   7e-05  2
(DY893091) CeleSEQ12275 Cunninghamella elegans pBluescript (...    42   7e-05  3
(ER439161) 1092963807211 Global-Ocean-Sampling_GS-35-01-01-1...    54   7e-05  3
(EU016638) Uncultured Group I marine crenarchaea HF4000APKG5...    50   8e-05  2
(DY888770) CeleSEQ6073 Cunninghamella elegans pBluescript (E...    42   8e-05  3
(FE685406) Pv009B_M13F_G09.ab1 Phaseolus vulgaris cv Early g...    46   9e-05  2
(BM275021) PfESToaa78f10.y1 Plasmodium falciparum 3D7 gameto...    38   9e-05  3
(CA901746) PCSC15903 Scarlet Runner Bean Suspensor Region Tr...    46   9e-05  2
(FE711062) Pv031C_M13F_B11.ab1 Phaseolus vulgaris cv Early g...    46   9e-05  2
(FD791585) 07VANA7_T7_043_A02_01MAR2006_016 07VANA7 Phaseolu...    46   9e-05  2
(AY049067) Emericella nidulans phosphoenolpyruvate carboxyki...    48   9e-05  4
(FC923660) C31707F01EF StrClemenN Citrus clementina cDNA clo...    36   1e-04  4
(EC999896) ROE00008828 Rhizopus oryzae Company Rhizopus oryz...    34   1e-04  4
(EJ916581) 1093018563819 Global-Ocean-Sampling_GS-30-02-01-1...    44   1e-04  2
(EK224457) 1095460154078 Global-Ocean-Sampling_GS-31-01-01-1...    34   1e-04  5
(EX803393) CAPI2473.fwd CAPI Laccaria bicolor Mycelium inter...    36   1e-04  4
(DB642865) Saccharomyces cerevisiae mRNA, clone: S03052-24_L...    34   1e-04  5
(BM779080) EST589655 KV2 Medicago truncatula cDNA clone pKV2...    46   1e-04  4
(EK229085) 1095460172139 Global-Ocean-Sampling_GS-31-01-01-1...    34   1e-04  5
(CT765456) Paramecium tetraurelia 5-PRIME EST from clone LK0...    56   2e-04  2
(DR617380) EST1007508 FvH Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR611193) EST1001321 FvG Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR615732) EST1005860 FvH Gibberella moniliformis cDNA clone...    48   2e-04  2
(DT483836) WS02523.B21_L09 PT-MB-N-A-15 Populus trichocarpa ...    36   2e-04  4
(EL910365) INIT2_39_F04.b1_A006 G5 trophont cDNA (INIT2) Ich...    58   2e-04  2
(EB715349) F-1032 Melon phloem library F Cucumis melo cDNA c...    52   2e-04  2
(EL916233) INIT2_17_G01.g1_A006 G5 trophont cDNA (INIT2) Ich...    58   2e-04  2
(EL916224) INIT2_100_H02.g1_A006 G5 trophont cDNA (INIT2) Ic...    58   2e-04  2
(DR613661) EST1003789 FvH Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR606497) EST996625 FvG Gibberella moniliformis cDNA clone ...    48   2e-04  2
(GR244591) CCON3161.g1 CCON Tremella mesenterica jelly fungu...    42   2e-04  3
(FE472896) CAOS4210.fwd CAOS Selaginella moellendorffii mixe...    46   2e-04  2
(DR619792) EST1009920 FvH Gibberella moniliformis cDNA clone...    46   2e-04  2
(DR613695) EST1003823 FvH Gibberella moniliformis cDNA clone...    48   2e-04  2
(EL912418) INIT2_51_H11.g1_A006 G5 trophont cDNA (INIT2) Ich...    58   2e-04  2
(FE471744) CAOS3618.fwd CAOS Selaginella moellendorffii mixe...    46   2e-04  2
(FE511445) CAOU7410.fwd CAOU Selaginella moellendorffii mixe...    46   2e-04  2
(EI013086) bb40h09.f Dekkera bruxellensis Random Genomic Lib...    50   2e-04  3
(DR638761) EST1029386 FvM Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR636199) EST1026824 FvM Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR624913) EST1015041 FvI Gibberella moniliformis cDNA clone...    48   2e-04  2
(EJ587790) 1092961028405 Global-Ocean-Sampling_GS-29-01-01-1...    44   2e-04  2
(DR643061) EST1033686 FvM Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR648848) EST1038965 FvN Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR639266) EST1029891 FvM Gibberella moniliformis cDNA clone...    48   2e-04  2
(DR638658) EST1029283 FvM Gibberella moniliformis cDNA clone...    48   2e-04  2
(EJ524322) 1092955172344 Global-Ocean-Sampling_GS-29-01-01-1...    44   2e-04  2
(EK028665) 1092955390279 Global-Ocean-Sampling_GS-31-01-01-1...    40   2e-04  3
(BM399320) 5009-0-56-E08.t.2 Chilcoat/Turkewitz cDNA (large ...    50   2e-04  3
(DT759014) EST1192863 Aquilegia cDNA library Aquilegia formo...    42   3e-04  3
(EK336066) 1095467042365 Global-Ocean-Sampling_GS-31-01-01-1...    40   3e-04  3
(ER470121) 1092963948016 Global-Ocean-Sampling_GS-35-01-01-1...    40   3e-04  2
(DV760795) PchrSEQ003124 Phanerochaete chrysosporium pBluesc...    42   3e-04  3
(GE343935) MEUA693TF JCVI-MT2 Medicago truncatula cDNA 5', m...    46   3e-04  4
(EW700897) EST00637 Hemp Uni-ZAP XR cDNA library Cannabis sa...    36   3e-04  4
(CP000903) Bacillus weihenstephanensis KBAB4, complete genome.     60   3e-04  1
(CP000817) Lysinibacillus sphaericus C3-41, complete genome.       60   3e-04  1
(AM740937) Cucumis melo subsp. melo EST, clone 46d_17-C05-M13R.    38   4e-04  4
(DB646090) Saccharomyces cerevisiae mRNA, clone: S03052-42_D...    34   4e-04  5
(EE063009) C1G07220 Mixture of buds, little clusters and fru...    32   4e-04  3
(CF686293) CCAEA28TO C.neoformans strain JEC21 Cryptococcus ...    36   4e-04  4
(CF683859) CCAF544TO C.neoformans strain JEC21 Cryptococcus ...    36   4e-04  4
(FD682539) CBHX2212.fwd CBHX Mycosphaerella fijiensis MfEST4...    36   4e-04  4
(DV755525) PchrSEQ809 Phanerochaete chrysosporium pBluescrip...    42   4e-04  3
(DV753678) PchrSEQ1891 Phanerochaete chrysosporium pBluescri...    42   4e-04  3
(DV134463) CV03108B1E11.f1 CV03-normalized library Euphorbia...    38   5e-04  3
(FG586322) TpNBL014949 Trichinella pseudospiralis new born l...    50   5e-04  2
(EB019378) LscoSEQ11173 Leucosporidium scottii pBluescript (...    56   5e-04  2
(DV760789) PchrSEQ001457 Phanerochaete chrysosporium pBluesc...    42   6e-04  3
(EB021322) LscoSEQ13515 Leucosporidium scottii pBluescript (...    56   6e-04  2
(GR782387) CBWO10255.b1 CBWO Melampsora larici-populina germ...    44   6e-04  3
(DY859618) ApulSEQ12168 Aureobasidium pullulans pBluescript ...    44   6e-04  3
(DV760802) PchrSEQ005164 Phanerochaete chrysosporium pBluesc...    42   6e-04  3
(DV760791) PchrSEQ001741 Phanerochaete chrysosporium pBluesc...    42   6e-04  3
(DV760797) PchrSEQ004030 Phanerochaete chrysosporium pBluesc...    42   6e-04  3
(DV760792) PchrSEQ002289 Phanerochaete chrysosporium pBluesc...    42   7e-04  3
(EB018417) LscoSEQ10092 Leucosporidium scottii pBluescript (...    56   7e-04  2
(DV760803) PchrSEQ005226 Phanerochaete chrysosporium pBluesc...    42   7e-04  3
(DV756743) PchrSEQ5436 Phanerochaete chrysosporium pBluescri...    42   7e-04  3
(EB021482) LscoSEQ13699 Leucosporidium scottii pBluescript (...    56   7e-04  2
(DR618681) EST1008809 FvH Gibberella moniliformis cDNA clone...    46   7e-04  2
(CK275094) EST721172 potato abiotic stress cDNA library Sola...    32   7e-04  5
(EB028297) LscoSEQ8829 Leucosporidium scottii pBluescript (E...    56   7e-04  2
(CK266796) EST712874 potato abiotic stress cDNA library Sola...    32   7e-04  5
(EB010720) LedoSEQ12837 Lentinula edodes pBluescript (EcoRI-...    48   7e-04  3
(FD666867) CBHT1573.fwd CBHT Mycosphaerella fijiensis MfEST3...    44   7e-04  3
(FD667322) CBHT1825.fwd CBHT Mycosphaerella fijiensis MfEST3...    44   7e-04  3
(EB021916) LscoSEQ14245 Leucosporidium scottii pBluescript (...    56   8e-04  2
(DW489249) GH_RMIRS_074_A05_R Cotton Normalized Library rand...    46   8e-04  3
(FD678552) CBHW2266.fwd CBHW Mycosphaerella fijiensis MfEST4...    44   8e-04  3
(DW489248) GH_RMIRS_074_A05_F Cotton Normalized Library rand...    46   8e-04  3

>(BJ346257) Dictyostelium discoideum cDNA clone:dda30j10, 3' end,
            single read.
          Length = 755

 Score = 1473 bits (743), Expect = 0.0
 Identities = 746/747 (99%)
 Strand = Plus / Minus


Query: 968  cgtgaaaaggaaccagagatctttgatgccatcaagtttggtgctgttttagagaatgtc 1027
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 755  cgtgaaaaggaaccagagatctttgatgccatcaagtttggtgctgttttagagaatgtc 696


Query: 1028 gtctacaatgagtactctcgtaaggtcgattacaatgatgtctctatcactgagaacacc 1087
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 695  gtctacaatgagtactctcgtaaggtcgattacaatgatgtctctatcactgagaacacc 636


Query: 1088 cgttgtgcctacccattggaacatatcccaaatgccaaattcccagctattgccggtcat 1147
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 635  cgttgtgcctacccattggaacatatcccaaatgccaaattcccagctattgccggtcat 576


Query: 1148 ccaaagaatatcattatgttaacttgtgatgcttttggtattctcccaccagtatctcgt 1207
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 575  ccaaagaatatcattatgttaacttgtgatgcttttggtattctcccaccagtatctcgt 516


Query: 1208 ttagatgccaatcaagttatgtaccatttcattcaaggttataccgccaaagttgccggt 1267
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 515  ttagatgccaatcaagttatgtaccatttcattcaaggttataccgccaaagctgccggt 456


Query: 1268 actgaagttggtgtcaccgaaccaactgcaaccttttcaagttgttatggtgaaccattc 1327
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455  actgaagttggtgtcaccgaaccaactgcaaccttttcaagttgttatggtgaaccattc 396


Query: 1328 atcgtatggcatccaaccaaatacgctgaaatgttggcttctcaactccataaacattca 1387
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395  atcgtatggcatccaaccaaatacgctgaaatgttggcttctcaactccataaacattca 336


Query: 1388 gctcgtgcttggttaattaatactggttggactggtggttctcatggtgttggttctcgt 1447
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335  gctcgtgcttggttaattaatactggttggactggtggttctcatggtgttggttctcgt 276


Query: 1448 attaaattggcctacactcgtgccatcatcgatgccattcacagtggagaacttgaaaaa 1507
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275  attaaattggcctacactcgtgccatcatcgatgccattcacagtggagaacttgaaaaa 216


Query: 1508 attccaaccactaaaatggatgttttcggtttccaagtaccaaatagttgtccaggtgtt 1567
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215  attccaaccactaaaatggatgttttcggtttccaagtaccaaatagttgtccaggtgtt 156


Query: 1568 ccatctgaaattttaatgccaattaatggttgggctgataaagagaaatatgtttcaact 1627
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155  ccatctgaaattttaatgccaattaatggttgggctgataaagagaaatatgtttcaact 96


Query: 1628 atgcataaattggctaaattatttattgaaaatttcaaaaaattccaagataaagcttca 1687
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95   atgcataaattggctaaattatttattgaaaatttcaaaaaattccaagataaagcttca 36


Query: 1688 ccagaacttgtagcagccggtccaata 1714
            |||||||||||||||||||||||||||
Sbjct: 35   ccagaacttgtagcagccggtccaata 9

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 108600042
Number of Hits to DB: 1,987,621,037
Number of extensions: 107636935
Number of successful extensions: 8560879
Number of sequences better than 10.0: 1264
Length of query: 1896
Length of database: 106,710,029,556
Length adjustment: 24
Effective length of query: 1872
Effective length of database: 104,103,628,548
Effective search space: 194881992641856
Effective search space used: 194881992641856
X1: 11 (21.8 bits)
S2: 23 (46.1 bits)




Dictyostelium discoideum cDNA Project Home