Homology Contig-U12870-1 vs DNA
Query= Contig-U12870-1 (Contig-U12870-1Q) /CSM_Contig/Contig-U12870-1Q.Seq.d
(1896 letters)
Database: ddbj_A
108,600,042 sequences; 106,710,029,556 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(BJ346257) Dictyostelium discoideum cDNA clone:dda30j10, 3' ... 1473 0.0 1
(AU060917) Dictyostelium discoideum slug cDNA, clone SLC233. 1453 0.0 1
(BJ398162) Dictyostelium discoideum cDNA clone:dds11d10, 3' ... 1382 0.0 1
(BJ372643) Dictyostelium discoideum cDNA clone:ddc13c17, 3' ... 1380 0.0 1
(BJ346414) Dictyostelium discoideum cDNA clone:dda30h19, 3' ... 1374 0.0 1
(BJ341663) Dictyostelium discoideum cDNA clone:dda7k13, 3' e... 1362 0.0 1
(BJ373492) Dictyostelium discoideum cDNA clone:ddc3f09, 3' e... 1334 0.0 1
(BJ399556) Dictyostelium discoideum cDNA clone:dds6a18, 3' e... 1328 0.0 1
(BJ376565) Dictyostelium discoideum cDNA clone:ddc29g04, 3' ... 1271 0.0 1
(BJ328993) Dictyostelium discoideum cDNA clone:dda30j10, 5' ... 1227 0.0 2
(BJ328108) Dictyostelium discoideum cDNA clone:dda23a03, 5' ... 1221 0.0 1
(BJ359930) Dictyostelium discoideum cDNA clone:ddc3f09, 5' e... 1201 0.0 2
(BJ347520) Dictyostelium discoideum cDNA clone:dda27h11, 3' ... 1185 0.0 1
(AU039727) Dictyostelium discoideum slug cDNA, clone SLG272. 1176 0.0 3
(AU034185) Dictyostelium discoideum slug cDNA, clone SLC233. 1176 0.0 1
(BJ363907) Dictyostelium discoideum cDNA clone:ddc29g04, 5' ... 1168 0.0 1
(BJ361102) Dictyostelium discoideum cDNA clone:ddc9i24, 5' e... 1162 0.0 1
(BJ388626) Dictyostelium discoideum cDNA clone:dds6a18, 5' e... 1160 0.0 1
(BJ329116) Dictyostelium discoideum cDNA clone:dda30h19, 5' ... 1154 0.0 1
(BJ373585) Dictyostelium discoideum cDNA clone:ddc3d21, 3' e... 1118 0.0 1
(BJ324717) Dictyostelium discoideum cDNA clone:dda7k13, 5' e... 1098 0.0 1
(BJ377011) Dictyostelium discoideum cDNA clone:ddc22b10, 3' ... 1090 0.0 3
(BJ359045) Dictyostelium discoideum cDNA clone:ddc12f13, 5' ... 1055 0.0 2
(BJ359240) Dictyostelium discoideum cDNA clone:ddc13c17, 5' ... 977 0.0 2
(BJ359690) Dictyostelium discoideum cDNA clone:ddc2a01, 5' e... 1049 0.0 1
(BJ373356) Dictyostelium discoideum cDNA clone:ddc2a01, 3' e... 1029 0.0 1
(BJ328182) Dictyostelium discoideum cDNA clone:dda23b07, 5' ... 1019 0.0 1
(AU061832) Dictyostelium discoideum slug cDNA, clone SLG272. 926 0.0 1
(BJ360012) Dictyostelium discoideum cDNA clone:ddc3d21, 5' e... 884 0.0 1
(BJ358478) Dictyostelium discoideum cDNA clone:ddc1a19, 5' e... 724 0.0 2
(BJ345211) Dictyostelium discoideum cDNA clone:dda23a03, 3' ... 747 0.0 1
(GR565962) CBTF1954.b1 CBTF Dictyostelium purpureum 12 hr ve... 470 0.0 4
(GR578213) CBZY1122.b1 CBZY Dictyostelium purpureum 18 hr st... 470 0.0 3
(GR570698) CBTG1402.b1 CBTG Dictyostelium purpureum 12 hr ve... 470 e-175 3
(AU061163) Dictyostelium discoideum slug cDNA, clone SLD447. 597 e-166 1
(GR584611) CCAA2559.b1 CCAA Dictyostelium purpureum 0 hr sta... 434 e-160 4
(GR566907) CBTF2684.b1 CBTF Dictyostelium purpureum 12 hr ve... 168 e-157 6
(AU033487) Dictyostelium discoideum slug cDNA, clone SLA884. 559 e-154 1
(BJ345293) Dictyostelium discoideum cDNA clone:dda23b07, 3' ... 551 e-152 1
(AU061785) Dictyostelium discoideum slug cDNA, clone SLF875. 476 e-129 1
(GR569672) CBTF620.b1 CBTF Dictyostelium purpureum 12 hr veg... 202 e-113 6
(GR584612) CCAA2559.g1 CCAA Dictyostelium purpureum 0 hr sta... 165 e-110 5
(BJ374683) Dictyostelium discoideum cDNA clone:ddc9i24, 3' e... 394 e-105 1
(GR584636) CCAA2580.b1 CCAA Dictyostelium purpureum 0 hr sta... 161 e-100 6
(GR565963) CBTF1954.g1 CBTF Dictyostelium purpureum 12 hr ve... 123 2e-97 6
(GR577759) CBXW780.b1 CBXW Dictyostelium purpureum 6 hr vege... 161 9e-95 6
(GR570699) CBTG1402.g1 CBTG Dictyostelium purpureum 12 hr ve... 165 5e-94 5
(BJ373157) Dictyostelium discoideum cDNA clone:ddc1a19, 3' e... 341 6e-89 1
(GR578214) CBZY1122.g1 CBZY Dictyostelium purpureum 18 hr st... 165 5e-83 4
(AU052704) Dictyostelium discoideum slug cDNA, clone SLD804. 295 3e-75 1
(AU061345) Dictyostelium discoideum slug cDNA, clone SLD804. 293 1e-74 1
(GR584637) CCAA2580.g1 CCAA Dictyostelium purpureum 0 hr sta... 123 7e-69 4
(AU053177) Dictyostelium discoideum slug cDNA, clone SLF875. 250 2e-61 1
(GR585006) CCAA2873.b1 CCAA Dictyostelium purpureum 0 hr sta... 161 1e-54 5
(BJ360642) Dictyostelium discoideum cDNA clone:ddc7j03, 5' e... 222 4e-53 1
(DY894977) CeleSEQ14682 Cunninghamella elegans pBluescript (... 78 5e-41 6
(U70473) Candida albicans PEP carboxykinase (PCK1) gene, com... 70 2e-40 8
(DL131137) Bax-responsive genes for drug target identificati... 70 2e-40 7
(AX536984) Sequence 585 from Patent WO02064766. 70 2e-40 7
(AX489612) Sequence 6912 from Patent WO02053728. 70 2e-40 7
(AR941697) Sequence 585 from patent US 7101990. 70 2e-40 7
(AR547862) Sequence 2993 from patent US 6747137. 70 2e-40 7
(DY893961) CeleSEQ13429 Cunninghamella elegans pBluescript (... 78 3e-40 5
(DY887482) CeleSEQ3839 Cunninghamella elegans pBluescript (E... 78 3e-40 5
(DY890575) CeleSEQ9625 Cunninghamella elegans pBluescript (E... 78 4e-40 5
(DY894706) CeleSEQ14338 Cunninghamella elegans pBluescript (... 78 6e-38 5
(DY886685) CeleSEQ2432 Cunninghamella elegans pBluescript (E... 78 9e-38 5
(DY890787) CeleSEQ7236 Cunninghamella elegans pBluescript (E... 78 2e-34 5
(DY892825) CeleSEQ11842 Cunninghamella elegans pBluescript (... 78 3e-34 5
(DY886476) CeleSEQ2146 Cunninghamella elegans pBluescript (E... 78 3e-34 4
(DY892539) CeleSEQ11096 Cunninghamella elegans pBluescript (... 78 4e-34 5
(DL131165) Bax-responsive genes for drug target identificati... 70 7e-34 7
(AX537040) Sequence 641 from Patent WO02064766. 70 7e-34 7
(AR941725) Sequence 641 from patent US 7101990. 70 7e-34 7
(DY890324) CeleSEQ9290 Cunninghamella elegans pBluescript (E... 70 5e-32 5
(DY891299) CeleSEQ8015 Cunninghamella elegans pBluescript (E... 78 5e-32 5
(DY891958) CeleSEQ8729 Cunninghamella elegans pBluescript (E... 78 9e-31 4
(EA397149) Sequence 45973 from patent US 7314974. 58 4e-29 9
(DL345250) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS. 58 7e-29 8
(DJ211699) Method for identification of useful proteins deri... 58 7e-29 8
(HB223965) Sequence 82319 from Patent WO2006024951. 58 7e-29 8
(HA294077) Sequence 82319 from Patent WO2006024892. 58 7e-29 8
(DY887444) CeleSEQ3771 Cunninghamella elegans pBluescript (E... 78 2e-28 4
(DY886654) CeleSEQ2392 Cunninghamella elegans pBluescript (E... 56 2e-28 6
(DL130976) Bax-responsive genes for drug target identificati... 58 3e-28 9
(AX536662) Sequence 263 from Patent WO02064766. 58 3e-28 9
(AR941536) Sequence 263 from patent US 7101990. 58 3e-28 9
(AL423880) T7 end of clone AZ0AA011A11 of library AZ0AA from... 70 3e-28 7
(Z28322) S.cerevisiae chromosome XI reading frame ORF YKR097w. 58 1e-27 9
(AY723843) Saccharomyces cerevisiae clone FLH004468.01X YKR0... 58 2e-27 9
(U24234) Saccharomyces cerevisiae phosphoenolpyruvate carbox... 58 2e-27 8
(X13096) Yeast gene for phosphoenolpyruvate carboxykinase. 58 1e-25 7
(EL914955) INIT2_84_G04.g2_A006 G5 trophont cDNA (INIT2) Ich... 58 2e-25 6
(EE674442) EST1542 Mycelia Grown in Nitrogen Limited Media C... 76 5e-25 3
(L42943) Staphylococcus aureus (clone KIN50) phosphoenolpyru... 62 5e-25 6
(FJ826618) Epichloe festucae strain E2368 phosphoenolpyruvat... 50 2e-24 8
(DY893990) CeleSEQ13464 Cunninghamella elegans pBluescript (... 56 3e-24 5
(DD119735) STAPHYLOCOCCUS AUREUS PROTEINS AND NUCLEIC ACIDS. 62 4e-24 5
(CS708243) Sequence 783 from Patent EP1829892. 62 4e-24 5
(AX617820) Sequence 783 from Patent WO02094868. 62 4e-24 5
(U51133) Staphylococcus aureus phosphoenolpyruvate carboxyki... 62 6e-24 5
(DY886301) CeleSEQ1904 Cunninghamella elegans pBluescript (E... 66 7e-24 5
(DY888387) CeleSEQ5315 Cunninghamella elegans pBluescript (E... 62 3e-23 4
(DY890606) CeleSEQ9668 Cunninghamella elegans pBluescript (E... 56 5e-23 5
(DY886755) CeleSEQ2526 Cunninghamella elegans pBluescript (E... 56 8e-23 5
(DY888091) CeleSEQ3522 Cunninghamella elegans pBluescript (E... 58 2e-22 4
(DY886809) CeleSEQ2601 Cunninghamella elegans pBluescript (E... 58 2e-22 4
(CT744243) Paramecium tetraurelia 5-PRIME EST from clone LK0... 56 3e-22 5
(CT740857) Paramecium tetraurelia 5-PRIME EST from clone LK0... 56 5e-22 5
(DL168698) Methods for Identifying the Target of a Compound ... 62 7e-22 4
(DJ374433) Identification of Essential Genes in Prokaryotes. 62 7e-22 4
(DL171310) Methods for Identifying the Target of a Compound ... 62 7e-22 4
(DJ377045) Identification of Essential Genes in Prokaryotes. 62 7e-22 4
(AR535581) Sequence 143 from patent US 6737248. 62 1e-21 6
(AR354025) Sequence 143 from patent US 6593114. 62 1e-21 6
(DY891032) CeleSEQ7550 Cunninghamella elegans pBluescript (E... 56 2e-21 4
(AM678867) Entamoeba terrapinae GSS, clone terra166f03.p1k. 62 2e-21 4
(HA167050) Sequence 8224 from Patent WO2005014857. 62 3e-21 5
(HA149690) Sequence 372 from Patent WO2005014857. 62 3e-21 5
(CA283743) SCSBSD1058G12.g SD1 Saccharum officinarum cDNA cl... 64 1e-20 4
(EB811618) 3759_I22 Botrytis cinerea expressed sequence tags... 64 6e-20 4
(DY886059) CeleSEQ1547 Cunninghamella elegans pBluescript (E... 60 1e-19 4
(EL912332) INIT2_51_H11.b1_A006 G5 trophont cDNA (INIT2) Ich... 58 1e-19 5
(DY894056) CeleSEQ13547 Cunninghamella elegans pBluescript (... 66 2e-19 4
(DY894165) CeleSEQ13676 Cunninghamella elegans pBluescript (... 54 4e-19 6
(FE233884) CAPG2521.rev CAPG Naegleria gruberi amoeba stage ... 52 5e-19 3
(FE236144) CAPG3738.rev CAPG Naegleria gruberi amoeba stage ... 52 5e-19 3
(FE243661) CAPG7764.rev CAPG Naegleria gruberi amoeba stage ... 52 5e-19 3
(FE231297) CAPG10355.rev CAPG Naegleria gruberi amoeba stage... 52 5e-19 3
(AL419513) T7 end of clone XAX0AA001A05 of library XAX0AA fr... 62 6e-19 4
(CR382137) Debaryomyces hansenii strain CBS767 chromosome E ... 62 3e-18 17
(DL266020) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS. 58 5e-18 7
(DJ132469) Method for identification of useful proteins deri... 58 5e-18 7
(HB144735) Sequence 3089 from Patent WO2006024951. 58 5e-18 7
(HA141388) Sequence 3089 from Patent WO2006024892. 58 5e-18 7
(FE233885) CAPG2521.fwd CAPG Naegleria gruberi amoeba stage ... 50 7e-18 5
(EK316620) 1095462415374 Global-Ocean-Sampling_GS-31-01-01-1... 52 9e-18 5
(DY894064) CeleSEQ13555 Cunninghamella elegans pBluescript (... 56 6e-17 4
(AF157622) Plasmodium falciparum phosphoenolpyruvate carboxy... 44 8e-17 7
(FM992695) Candida dubliniensis CD36 chromosome R, complete ... 62 1e-16 17
(EB802386) 3466_L23 Botrytis cinerea expressed sequence tags... 64 2e-16 3
(EB802201) 3466_E04 Botrytis cinerea expressed sequence tags... 64 2e-16 3
(EK043002) 1092959532543 Global-Ocean-Sampling_GS-31-01-01-1... 52 4e-16 3
(EL915267) INIT2_88_F08.g1_A006 G5 trophont cDNA (INIT2) Ich... 58 2e-15 4
(CP000703) Staphylococcus aureus subsp. aureus JH9, complete... 62 4e-15 3
(CP000736) Staphylococcus aureus subsp. aureus JH1, complete... 62 4e-15 3
(AP009324) Staphylococcus aureus subsp. aureus Mu3 DNA, comp... 62 4e-15 3
(AP009351) Staphylococcus aureus subsp. aureus str. Newman D... 62 4e-15 3
(BA000017) Staphylococcus aureus subsp. aureus Mu50 DNA, com... 62 4e-15 3
(CP000730) Staphylococcus aureus subsp. aureus USA300_TCH151... 62 4e-15 3
(CP000255) Staphylococcus aureus subsp. aureus USA300_FPR375... 62 4e-15 3
(CP000253) Staphylococcus aureus subsp. aureus NCTC 8325, co... 62 4e-15 3
(BA000018) Staphylococcus aureus subsp. aureus N315 DNA, com... 62 4e-15 3
(CP000046) Staphylococcus aureus subsp. aureus COL, complete... 62 4e-15 3
(BA000033) Staphylococcus aureus subsp. aureus MW2 DNA, comp... 62 1e-14 3
(BX571857) Staphylococcus aureus strain MSSA476, complete ge... 62 1e-14 3
(AJ938182) Staphylococcus aureus RF122 complete genome. 62 1e-14 3
(EJ194877) 1092344227766 Global-Ocean-Sampling_GS-27-01-01-1... 40 1e-14 5
(FE268953) CAZO940.fwd CAZO Naegleria gruberi Flagellate Sta... 52 7e-14 3
(CT767645) Paramecium tetraurelia 5-PRIME EST from clone LK0... 56 2e-13 4
(DN451698) EST947497 Sequencing ESTs from loblolly pine embr... 58 2e-13 4
(DY891526) CeleSEQ10245 Cunninghamella elegans pBluescript (... 56 2e-13 4
(U88575) Kluyveromyces lactis phosphoenolpyruvate carboxykin... 58 3e-13 5
(CT776872) Paramecium tetraurelia 5-PRIME EST from clone LK0... 52 3e-13 5
(EK514526) 1095515492656 Global-Ocean-Sampling_GS-32-01-01-1... 44 3e-13 5
(DY886469) CeleSEQ2135 Cunninghamella elegans pBluescript (E... 44 6e-13 4
(EK276264) 1095462278552 Global-Ocean-Sampling_GS-31-01-01-1... 46 7e-13 4
(BX571856) Staphylococcus aureus subsp. aureus strain MRSA25... 62 8e-13 3
(CN596025) TTE00007045 Normalized large Tetrahymena thermoph... 58 8e-13 5
(EK313490) 1095462405226 Global-Ocean-Sampling_GS-31-01-01-1... 52 2e-12 4
(DY887146) CeleSEQ3050 Cunninghamella elegans pBluescript (E... 56 3e-12 3
(EK132120) 1093010129304 Global-Ocean-Sampling_GS-31-01-01-1... 40 3e-12 5
(ER460161) 1092963888806 Global-Ocean-Sampling_GS-35-01-01-1... 40 5e-12 5
(BB975623) Plasmodium berghei str. ANKA cDNA clone: OK005461... 56 5e-12 3
(DW138000) CLSY5433.b1_A15.ab1 CLS(XYZ) lettuce sativa Lactu... 72 6e-12 2
(DY960537) CLSM10876.b1_H07.ab1 CLS(LMS) lettuce sativa Lact... 72 7e-12 2
(DY895286) CeleSEQ15077 Cunninghamella elegans pBluescript (... 62 9e-12 3
(DY894968) CeleSEQ14668 Cunninghamella elegans pBluescript (... 62 1e-11 3
(CP000851) Shewanella pealeana ATCC 700345, complete genome. 52 1e-11 3
(DY893067) CeleSEQ12238 Cunninghamella elegans pBluescript (... 62 1e-11 3
(DY892342) CeleSEQ10538 Cunninghamella elegans pBluescript (... 62 1e-11 3
(DY894507) CeleSEQ14092 Cunninghamella elegans pBluescript (... 62 1e-11 3
(DY894786) CeleSEQ14444 Cunninghamella elegans pBluescript (... 62 1e-11 3
(EC761509) PSE00004847 rw_mgpallid Polysphondylium pallidum ... 68 1e-11 2
(GR304793) WRIS_5521 cDNA library of a compatible interactio... 44 2e-11 4
(ER401166) 1095351005512 Global-Ocean-Sampling_GS-34-01-01-1... 54 2e-11 4
(DW126628) CLSX3171.b1_F01.ab1 CLS(XYZ) lettuce sativa Lactu... 70 2e-11 2
(DY887378) CeleSEQ3350 Cunninghamella elegans pBluescript (E... 44 3e-11 4
(DB650783) Saccharomyces cerevisiae mRNA, clone: S03052-79_E... 58 4e-11 5
(GP280034) Sequence 12214 from patent US 7504493. 58 5e-11 12
(DJ025879) Genome-wide DNA marker of Saccharomyces cerevisiae. 58 5e-11 12
(DU779801) ASXB2889.b2 HF500_10-06-02 uncultured marine micr... 46 5e-11 3
(DT375051) Conidia_7-B12.g Aerial conidia Cordyceps bassiana... 50 6e-11 3
(DT373008) Chitin_4-D06.e Chitin-grown Cordyceps bassiana cD... 50 7e-11 3
(DY964251) CLSM14808.b1_O06.ab1 CLS(LMS) lettuce sativa Lact... 68 9e-11 2
(CN593810) TTE00009341 Normalized large Tetrahymena thermoph... 58 1e-10 4
(CP000764) Bacillus cereus subsp. cytotoxis NVH 391-98, comp... 60 1e-10 2
(GM729519) Sequence 6182 from Patent WO2008048614. 42 2e-10 6
(GM725302) Sequence 1965 from Patent WO2008048614. 42 2e-10 6
(DT376604) Oosporein_11-D03.e Oosporein-producing Cordyceps ... 46 3e-10 3
(CT769068) Paramecium tetraurelia 5-PRIME EST from clone LK0... 52 3e-10 3
(BZ298839) CG4612.r1 Candida glabrata Random Genomic Library... 48 5e-10 4
(AY007226) Lycopersicon esculentum phosphoenolpyruvate carbo... 40 6e-10 6
(FC874138) C31202G07EF BiotPhyR1 Citrus aurantium cDNA clone... 42 8e-10 4
(CF686562) CCAH834TF C.neoformans strain JEC21 Cryptococcus ... 52 1e-09 4
(CX071999) UCRCS08_25D11_g Parent Washington Navel Orange Ca... 42 1e-09 4
(DT625185) EST1159460 Sequencing ESTs from loblolly pine emb... 58 1e-09 3
(CF684964) CCAI253TF C.neoformans strain JEC21 Cryptococcus ... 52 1e-09 4
(FE243662) CAPG7764.fwd CAPG Naegleria gruberi amoeba stage ... 48 1e-09 4
(FE236145) CAPG3738.fwd CAPG Naegleria gruberi amoeba stage ... 48 1e-09 4
(CF698894) CCAFP36TO C.neoformans strain JEC21 Cryptococcus ... 52 1e-09 4
(DW135383) CLSY2899.b1_E06.ab1 CLS(XYZ) lettuce sativa Lactu... 56 1e-09 2
(EF038416) Synthetic construct Bacillus anthracis clone FLH2... 52 1e-09 5
(ER431070) 1092963778090 Global-Ocean-Sampling_GS-35-01-01-1... 40 1e-09 4
(CT776879) Paramecium tetraurelia 5-PRIME EST from clone LK0... 52 2e-09 4
(CF714093) CCAA119TF C.neoformans strain JEC21 Cryptococcus ... 52 2e-09 4
(CQ447655) Sequence 13415 from Patent WO0192523. 54 2e-09 3
(EY834374) PT11-C2-301-010-C03-CT.F Poncirus trifoliata bark... 42 2e-09 4
(CN594744) TTE00011461 Normalized large Tetrahymena thermoph... 38 2e-09 5
(CP000497) Pichia stipitis CBS 6054 chromosome 3, complete s... 64 2e-09 2
(CF397493) RTDS3_3_F06.g1_A022 Drought-stressed loblolly pin... 58 2e-09 3
(CT814648) Paramecium tetraurelia 5-PRIME EST from clone LK0... 52 2e-09 4
(CF676313) CCAEE61TO C.neoformans strain JEC21 Cryptococcus ... 52 2e-09 4
(CK268981) EST715059 potato abiotic stress cDNA library Sola... 40 3e-09 5
(CT749430) Paramecium tetraurelia 5-PRIME EST from clone LK0... 42 3e-09 5
(EK088835) 1092961191458 Global-Ocean-Sampling_GS-31-01-01-1... 46 3e-09 3
(CN589247) TTE00004638 Normalized large Tetrahymena thermoph... 44 3e-09 4
(DV126232) CV03044B1F02.f1 CV03-normalized library Euphorbia... 40 3e-09 4
(DY890337) CeleSEQ9314 Cunninghamella elegans pBluescript (E... 36 4e-09 6
(EH683515) CCIL8203.b1_F11.ab1 CCI(LMS) chicory Cichorium in... 58 4e-09 2
(EH672834) CCIL10467.b1_F01.ab1 CCI(LMS) chicory Cichorium i... 58 5e-09 2
(CX070354) UCRCS08_16C10_g Parent Washington Navel Orange Ca... 42 5e-09 4
(CP000447) Shewanella frigidimarina NCIMB 400, complete genome. 62 6e-09 2
(DB647327) Saccharomyces cerevisiae mRNA, clone: S03052-48_I... 50 7e-09 5
(CT766910) Paramecium tetraurelia 5-PRIME EST from clone LK0... 52 7e-09 4
(L31899) Cucumber phosphoenolpyruvate carboxykinase (pck) ge... 52 7e-09 4
(FE268952) CAZO940.rev CAZO Naegleria gruberi Flagellate Sta... 52 8e-09 2
(GR569673) CBTF620.g1 CBTF Dictyostelium purpureum 12 hr veg... 66 9e-09 2
(CT788689) Paramecium tetraurelia 5-PRIME EST from clone LK0... 40 1e-08 5
(GP248072) Sequence 2408 from patent US 7504490. 46 1e-08 4
(DY992547) GpanSEQ10803 Geomyces pannorum pBluescript (EcoRI... 56 2e-08 5
(DY989257) GpanSEQ6589 Geomyces pannorum pBluescript (EcoRI-... 56 2e-08 5
(DV438896) davisf0006K01 Fragaria vesca 'Yellow Wonder' flow... 44 2e-08 4
(EA391267) Sequence 40091 from patent US 7314974. 62 2e-08 2
(GR582814) CBZZ979.g1 CBZZ Dictyostelium purpureum 18 hr sta... 74 2e-08 1
(GR385259) CCBI4277.b1 CCBI Cryphonectria parasitica pool of... 50 3e-08 3
(EK039101) 1092959497953 Global-Ocean-Sampling_GS-31-01-01-1... 50 4e-08 3
(EK032611) 1092956085341 Global-Ocean-Sampling_GS-31-01-01-1... 50 4e-08 3
(CB894009) EST646801 HOGA Medicago truncatula cDNA clone HOG... 46 4e-08 5
(EE009113) ROE00005343 Rhizopus oryzae Company Rhizopus oryz... 46 4e-08 4
(CF678240) CCAHW90TF C.neoformans strain JEC21 Cryptococcus ... 46 5e-08 4
(DR708400) Asn_09257 Aspergillus niger pBluescript (EcoRI-Xh... 46 6e-08 4
(CT751645) Paramecium tetraurelia 5-PRIME EST from clone LK0... 40 7e-08 4
(CT789149) Paramecium tetraurelia 5-PRIME EST from clone LK0... 40 7e-08 4
(AM270225) Aspergillus niger contig An11c0080, complete genome. 46 8e-08 6
(DR708407) Asn_09266 Aspergillus niger pBluescript (EcoRI-Xh... 46 8e-08 4
(CP001186) Bacillus cereus G9842, complete genome. 50 9e-08 2
(DW166734) CLVY5195.b1_E04.ab1 CLV(XYZ) lettuce virosa Lactu... 72 9e-08 1
(DW133842) CLSY1319.b1_N17.ab1 CLS(XYZ) lettuce sativa Lactu... 72 9e-08 1
(DW116317) CLRY4419.b1_E02.ab1 CLR(XYZ) lettuce serriola Lac... 72 9e-08 1
(DW114442) CLRY2558.b1_K16.ab1 CLR(XYZ) lettuce serriola Lac... 72 9e-08 1
(DW113344) CLRY1437.b1_I24.ab1 CLR(XYZ) lettuce serriola Lac... 72 9e-08 1
(DW052220) CLLX4933.b1_J10.ab1 CLL(XYZ) lettuce saligna Lact... 72 9e-08 1
(BU004613) QGG5L07.yg.ab1 QG_EFGHJ lettuce serriola Lactuca ... 72 9e-08 1
(FN005531) Petunia axillaris subsp. axillaris EST, clone dr0... 50 1e-07 4
(DR638515) EST1029140 FvM Gibberella moniliformis cDNA clone... 48 1e-07 3
(DR701449) Asn_00921 Aspergillus niger pBluescript (EcoRI-Xh... 46 1e-07 4
(DR701498) Asn_00978 Aspergillus niger pBluescript (EcoRI-Xh... 46 1e-07 4
(EY865488) CM30-C1-401-083-B06-CT.F Sweet lime leaf, infecte... 42 1e-07 3
(EA387302) Sequence 36126 from patent US 7314974. 48 1e-07 4
(EY244046) CATY4062.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY253929) CATY9453.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY253020) CATY8964.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY244225) CATY4152.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY244978) CATY4517.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY251439) CATY8078.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY253002) CATY8955.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EK178091) 1095458107290 Global-Ocean-Sampling_GS-31-01-01-1... 38 2e-07 4
(EY252965) CATY8935.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY250124) CATY7383.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY242573) CATY3281.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY238657) CATY1178.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(EY251334) CATY8019.fwd CATY Aspergillus niger fungal filame... 46 2e-07 4
(AF481231) Cucumis sativus PEPCK (Pepck) gene, complete cds. 52 2e-07 4
(DU794825) APKH5651.g2 HF770_12-21-03 uncultured marine micr... 40 3e-07 5
(CV649992) C08_01nc_plate_2as 01nc Neotyphodium coenophialum... 50 3e-07 3
(CU928174) Zygosaccharomyces rouxii strain CBS732 chromosome... 50 3e-07 2
(DV759290) PchrSEQ8374 Phanerochaete chrysosporium pBluescri... 46 3e-07 3
(FL864493) CCGI8457.b1 CCGI Panicum virgatum etiolated seedl... 48 4e-07 3
(EY243759) CATY3920.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY238861) CATY1285.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY250557) CATY7598.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY242869) CATY3438.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY250247) CATY7445.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY243439) CATY3753.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY247429) CATY6052.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY252121) CATY8437.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(EY243537) CATY3804.fwd CATY Aspergillus niger fungal filame... 46 4e-07 2
(DR701556) Asn_01042 Aspergillus niger pBluescript (EcoRI-Xh... 46 4e-07 2
(DR709199) Asn_10599 Aspergillus niger pBluescript (EcoRI-Xh... 46 4e-07 2
(BE436435) EST407513 tomato breaker fruit, TIGR Solanum lyco... 40 5e-07 4
(CT813344) Paramecium tetraurelia 5-PRIME EST from clone LK0... 40 5e-07 4
(GR531330) CCIA7866.b1 CCIA Mucor circinelloides from light ... 44 5e-07 3
(EJ768590) 1092963348874 Global-Ocean-Sampling_GS-30-02-01-1... 40 6e-07 3
(BQ622043) fch1c.pk003.p24 Conidiobolus cornatus ARSEF 512 C... 54 6e-07 2
(AW736528) EST332542 KV3 Medicago truncatula cDNA clone pKV3... 54 6e-07 3
(EK116881) 1092963256161 Global-Ocean-Sampling_GS-31-01-01-1... 40 8e-07 4
(EY726325) CS00-C3-703-089-C05-CT.F Sweet orange fruit, deve... 42 8e-07 4
(CV291038) aof01-15ms3-c12 Aof01 Asparagus officinalis cDNA ... 40 9e-07 4
(EY721156) CS00-C3-703-019-B05-CT.F Sweet orange fruit, deve... 42 9e-07 4
(EY759998) CR05-C1-100-022-D01-CT.F Mandarin leaf, greenhous... 42 9e-07 4
(BM396358) 5009-0-2-H01.t.1 Chilcoat/Turkewitz cDNA (large f... 50 1e-06 4
(EY656038) CS00-C1-100-115-B04-CT.F Sweet orange leaf, green... 42 1e-06 4
(CV886706) UCRCS04_2_024G03_T7 Ruby Orange Developing Flower... 42 1e-06 4
(CT768759) Paramecium tetraurelia 5-PRIME EST from clone LK0... 40 1e-06 4
(BM396769) 5009-0-25-A07.t.1 Chilcoat/Turkewitz cDNA (large ... 58 1e-06 3
(CN591710) TTE00014708 Normalized large Tetrahymena thermoph... 58 1e-06 3
(CP000931) Shewanella halifaxensis HAW-EB4, complete genome. 52 1e-06 2
(EY247735) CATY6209.fwd CATY Aspergillus niger fungal filame... 46 1e-06 3
(GE213384) 253 'BH' (somaclonal variated plants of Skaggs Bo... 42 1e-06 4
(EY890124) TS27-C2-300-072-G07-CT.F Sunki mandarin bark, gre... 42 1e-06 4
(EY860245) CM30-C1-401-004-H01-CT.F Sweet lime leaf, infecte... 42 1e-06 4
(EY674265) CS00-C1-102-020-F04-CT.F Sweet orange leaf, infec... 42 1e-06 4
(AP004576) Lotus japonicus genomic DNA, chromosome 2, clone:... 54 1e-06 2
(AP004577) Lotus japonicus genomic DNA, chromosome 2, clone:... 54 1e-06 2
(EU016665) Uncultured Group I marine crenarchaea HF4000APKG1... 50 1e-06 2
(BU008446) QGH7J22.yg.ab1 QG_EFGHJ lettuce serriola Lactuca ... 68 1e-06 1
(BU003946) QGG36P13.yg.ab1 QG_EFGHJ lettuce serriola Lactuca... 68 1e-06 1
(ER369355) 1093022165823 Global-Ocean-Sampling_GS-34-01-01-1... 48 2e-06 2
(FG524909) 030522KASB001149HT (KASB) Subtractive library usi... 54 2e-06 2
(FG400833) 010723KHFA004639HT (KHFA) A. arguta ripe fruit Ac... 54 2e-06 2
(AV421951) Lotus japonicus cDNA clone:MWM002e06_r, 5' end. 54 2e-06 2
(AM466633) Vitis vinifera, whole genome shotgun sequence, co... 38 2e-06 3
(DC900116) Citrus sinensis mRNA, clone: VS27V30, 5'-end sequ... 42 2e-06 4
(EC977118) WIN1033.C21_K04 Muscat Hamburg post-veraison peri... 38 2e-06 3
(DV756692) PchrSEQ5365 Phanerochaete chrysosporium pBluescri... 42 2e-06 4
(EC920149) WIN013.BR_G03 Cab Sauv pericarp non-normalized (W... 38 2e-06 3
(EE090328) S6B06493 Fruits 7-9 mm (VvS6) Vitis vinifera cDNA... 38 2e-06 3
(EE094731) S8B01093 Fruits Veraison (VvS8) Vitis vinifera cD... 38 2e-06 3
(EE095758) S8B02893 Fruits Veraison (VvS8) Vitis vinifera cD... 38 2e-06 3
(DT031816) VVL062B08_685258 CabSau Berry Postveraison Mixed ... 38 2e-06 3
(DT028834) VVL027F09_679294 CabSau Berry Postveraison Mixed ... 38 2e-06 3
(DT029431) VVL034E01_680488 CabSau Berry Postveraison Mixed ... 38 2e-06 3
(CF603993) BACCA01_001312 Grape Berry pSPORT1 Library Vitis ... 38 2e-06 3
(FD682274) CBHX2073.rev CBHX Mycosphaerella fijiensis MfEST4... 44 2e-06 4
(FG984952) aB2_B03_R Grape berry-specific cDNA library Vitis... 38 2e-06 3
(FG984779) aB2_B03_F Grape berry-specific cDNA library Vitis... 38 2e-06 3
(EE001633) ROE00013193 Rhizopus oryzae Company Rhizopus oryz... 46 2e-06 3
(FD682362) CBHX2119.fwd CBHX Mycosphaerella fijiensis MfEST4... 44 2e-06 4
(FD684479) CBHX4721.fwd CBHX Mycosphaerella fijiensis MfEST4... 44 2e-06 4
(FD674785) CBHU3556.fwd CBHU Mycosphaerella fijiensis MfEST3... 44 2e-06 4
(FD669430) CBHT3967.fwd CBHT Mycosphaerella fijiensis MfEST3... 44 2e-06 4
(FD672310) CBHU2176.fwd CBHU Mycosphaerella fijiensis MfEST3... 44 2e-06 4
(BB975602) Plasmodium berghei str. ANKA cDNA clone: OK005439... 56 3e-06 2
(BQ785985) saq62a12.y1 Gm-c1076 Glycine max cDNA clone SOYBE... 44 3e-06 3
(DB646070) Saccharomyces cerevisiae mRNA, clone: S03052-42_C... 40 3e-06 5
(BB981818) Plasmodium berghei str. ANKA cDNA clone: OK012128... 56 3e-06 2
(EE008095) ROE00003741 Rhizopus oryzae Company Rhizopus oryz... 46 3e-06 3
(DV757892) PchrSEQ7025 Phanerochaete chrysosporium pBluescri... 42 4e-06 4
(EJ100913) 1095469436042 Global-Ocean-Sampling_GS-26-01-01-1... 48 4e-06 2
(GR829200) CCCC3957.b1 CCCC Glycine max callus grown in dark... 44 5e-06 3
(CP000866) Nitrosopumilus maritimus SCM1, complete genome. 44 5e-06 2
(CF504605) USDA-FP_120000-094 Immature Ovaries from field-co... 42 5e-06 3
(DW146614) CLVX11726.b1_K04.ab1 CLV(XYZ) lettuce virosa Lact... 46 6e-06 3
(AW033260) EST276831 tomato callus, TAMU Solanum lycopersicu... 40 6e-06 4
(AR538477) Sequence 3039 from patent US 6737248. 52 6e-06 2
(AR356921) Sequence 3039 from patent US 6593114. 52 6e-06 2
(AW774795) EST333946 KV3 Medicago truncatula cDNA clone pKV3... 46 7e-06 4
(FD666723) CBHT1492.fwd CBHT Mycosphaerella fijiensis MfEST3... 44 7e-06 4
(EA375359) Sequence 24182 from patent US 7314974. 34 7e-06 3
(FD669536) CBHT4020.fwd CBHT Mycosphaerella fijiensis MfEST3... 44 8e-06 4
(EY429681) ZY008488 Aspergillus oryzae EST Library Aspergill... 36 8e-06 4
(GR236207) CCOI5346.b1 CCOI Tremella mesenterica jelly fungu... 36 9e-06 4
(CF682848) CCACD39TF C.neoformans strain JEC21 Cryptococcus ... 38 1e-05 4
(EL908538) INIT2_25_D09.g1_A006 G5 trophont cDNA (INIT2) Ich... 40 1e-05 3
(CT783616) Paramecium tetraurelia 5-PRIME EST from clone LK0... 58 1e-05 3
(AX145619) Sequence 4341 from Patent WO0134809. 50 1e-05 3
(AR486255) Sequence 4341 from patent US 6703492. 50 1e-05 3
(AF270301) Staphylococcus epidermidis strain SR1 clone step.... 50 1e-05 3
(BM396359) 5009-0-2-H01.t.2 Chilcoat/Turkewitz cDNA (large f... 36 2e-05 5
(CP001632) Capnocytophaga ochracea DSM 7271, complete genome. 34 2e-05 3
(CU856536) S.lycopersicum DNA sequence from clone SL_FOS-2F2... 40 2e-05 7
(DY889490) CeleSEQ11360 Cunninghamella elegans pBluescript (... 42 2e-05 3
(DV759039) PchrSEQ10026 Phanerochaete chrysosporium pBluescr... 42 2e-05 3
(CA581039) EST000714 Mycelium and yeast cells from Paracocci... 42 2e-05 4
(AR944917) Sequence 20 from patent US 7105723. 40 2e-05 5
(BU006370) QGH10N17.yg.ab1 QG_EFGHJ lettuce serriola Lactuca... 64 2e-05 1
(GR582748) CBZZ928.g1 CBZZ Dictyostelium purpureum 18 hr sta... 64 2e-05 1
(EY712639) CS00-C3-702-021-G04-CT.F Sweet orange fruit, deve... 42 2e-05 3
(DY822115) CTOY13921.b1_B01.ab1 CTO(XYZ) dandelion Taraxacum... 44 2e-05 2
(DY822149) CTOY13953.b1_B09.ab1 CTO(XYZ) dandelion Taraxacum... 44 2e-05 2
(DY821657) CTOY13495.b1_M13.ab1 CTO(XYZ) dandelion Taraxacum... 44 2e-05 2
(DY821808) CTOY13634.b1_C02.ab1 CTO(XYZ) dandelion Taraxacum... 44 2e-05 2
(CX544241) UCRPT01_5_012_B06_T7 Poncirus trifoliata CTV-chal... 42 2e-05 3
(AL388327) Medicago truncatula EST MtBC47H10F1 : T3 end of c... 38 3e-05 4
(EA074831) Sequence 2189 from patent US 7183083. 50 3e-05 2
(GC558541) Sequence 2252 from patent US 7416862. 50 3e-05 2
(AR888528) Sequence 2189 from patent US 7060458. 50 3e-05 2
(CR380954) Candida glabrata strain CBS138 chromosome H compl... 48 3e-05 16
(FG475545) 020217KALA006670HT (KALA) Dormant kiwifruit buds ... 44 3e-05 3
(AR944916) Sequence 19 from patent US 7105723. 40 3e-05 5
(GD283779) b1p15a8.r1 Cryptococcus neoformans strain 184A, g... 44 3e-05 4
(DY991712) GpanSEQ9589 Geomyces pannorum pBluescript (EcoRI-... 56 4e-05 3
(FG478580) 021009KALA009484HT (KALA) Dormant kiwifruit buds ... 44 4e-05 3
(AB226268) Aspergillus oryzae cDNA, contig sequence: AoEST3128. 36 4e-05 4
(CT786995) Paramecium tetraurelia 5-PRIME EST from clone LK0... 36 5e-05 4
(EJ464345) 1095388024768 Global-Ocean-Sampling_GS-28-01-01-1... 40 5e-05 4
(DN829625) KUCD01_11_D06_T3 WSWR cDNA library Triticum aesti... 38 6e-05 4
(DY891240) CeleSEQ7932 Cunninghamella elegans pBluescript (E... 46 6e-05 2
(AE009951) Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 7e-05 2
(DY893091) CeleSEQ12275 Cunninghamella elegans pBluescript (... 42 7e-05 3
(ER439161) 1092963807211 Global-Ocean-Sampling_GS-35-01-01-1... 54 7e-05 3
(EU016638) Uncultured Group I marine crenarchaea HF4000APKG5... 50 8e-05 2
(DY888770) CeleSEQ6073 Cunninghamella elegans pBluescript (E... 42 8e-05 3
(FE685406) Pv009B_M13F_G09.ab1 Phaseolus vulgaris cv Early g... 46 9e-05 2
(BM275021) PfESToaa78f10.y1 Plasmodium falciparum 3D7 gameto... 38 9e-05 3
(CA901746) PCSC15903 Scarlet Runner Bean Suspensor Region Tr... 46 9e-05 2
(FE711062) Pv031C_M13F_B11.ab1 Phaseolus vulgaris cv Early g... 46 9e-05 2
(FD791585) 07VANA7_T7_043_A02_01MAR2006_016 07VANA7 Phaseolu... 46 9e-05 2
(AY049067) Emericella nidulans phosphoenolpyruvate carboxyki... 48 9e-05 4
(FC923660) C31707F01EF StrClemenN Citrus clementina cDNA clo... 36 1e-04 4
(EC999896) ROE00008828 Rhizopus oryzae Company Rhizopus oryz... 34 1e-04 4
(EJ916581) 1093018563819 Global-Ocean-Sampling_GS-30-02-01-1... 44 1e-04 2
(EK224457) 1095460154078 Global-Ocean-Sampling_GS-31-01-01-1... 34 1e-04 5
(EX803393) CAPI2473.fwd CAPI Laccaria bicolor Mycelium inter... 36 1e-04 4
(DB642865) Saccharomyces cerevisiae mRNA, clone: S03052-24_L... 34 1e-04 5
(BM779080) EST589655 KV2 Medicago truncatula cDNA clone pKV2... 46 1e-04 4
(EK229085) 1095460172139 Global-Ocean-Sampling_GS-31-01-01-1... 34 1e-04 5
(CT765456) Paramecium tetraurelia 5-PRIME EST from clone LK0... 56 2e-04 2
(DR617380) EST1007508 FvH Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR611193) EST1001321 FvG Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR615732) EST1005860 FvH Gibberella moniliformis cDNA clone... 48 2e-04 2
(DT483836) WS02523.B21_L09 PT-MB-N-A-15 Populus trichocarpa ... 36 2e-04 4
(EL910365) INIT2_39_F04.b1_A006 G5 trophont cDNA (INIT2) Ich... 58 2e-04 2
(EB715349) F-1032 Melon phloem library F Cucumis melo cDNA c... 52 2e-04 2
(EL916233) INIT2_17_G01.g1_A006 G5 trophont cDNA (INIT2) Ich... 58 2e-04 2
(EL916224) INIT2_100_H02.g1_A006 G5 trophont cDNA (INIT2) Ic... 58 2e-04 2
(DR613661) EST1003789 FvH Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR606497) EST996625 FvG Gibberella moniliformis cDNA clone ... 48 2e-04 2
(GR244591) CCON3161.g1 CCON Tremella mesenterica jelly fungu... 42 2e-04 3
(FE472896) CAOS4210.fwd CAOS Selaginella moellendorffii mixe... 46 2e-04 2
(DR619792) EST1009920 FvH Gibberella moniliformis cDNA clone... 46 2e-04 2
(DR613695) EST1003823 FvH Gibberella moniliformis cDNA clone... 48 2e-04 2
(EL912418) INIT2_51_H11.g1_A006 G5 trophont cDNA (INIT2) Ich... 58 2e-04 2
(FE471744) CAOS3618.fwd CAOS Selaginella moellendorffii mixe... 46 2e-04 2
(FE511445) CAOU7410.fwd CAOU Selaginella moellendorffii mixe... 46 2e-04 2
(EI013086) bb40h09.f Dekkera bruxellensis Random Genomic Lib... 50 2e-04 3
(DR638761) EST1029386 FvM Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR636199) EST1026824 FvM Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR624913) EST1015041 FvI Gibberella moniliformis cDNA clone... 48 2e-04 2
(EJ587790) 1092961028405 Global-Ocean-Sampling_GS-29-01-01-1... 44 2e-04 2
(DR643061) EST1033686 FvM Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR648848) EST1038965 FvN Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR639266) EST1029891 FvM Gibberella moniliformis cDNA clone... 48 2e-04 2
(DR638658) EST1029283 FvM Gibberella moniliformis cDNA clone... 48 2e-04 2
(EJ524322) 1092955172344 Global-Ocean-Sampling_GS-29-01-01-1... 44 2e-04 2
(EK028665) 1092955390279 Global-Ocean-Sampling_GS-31-01-01-1... 40 2e-04 3
(BM399320) 5009-0-56-E08.t.2 Chilcoat/Turkewitz cDNA (large ... 50 2e-04 3
(DT759014) EST1192863 Aquilegia cDNA library Aquilegia formo... 42 3e-04 3
(EK336066) 1095467042365 Global-Ocean-Sampling_GS-31-01-01-1... 40 3e-04 3
(ER470121) 1092963948016 Global-Ocean-Sampling_GS-35-01-01-1... 40 3e-04 2
(DV760795) PchrSEQ003124 Phanerochaete chrysosporium pBluesc... 42 3e-04 3
(GE343935) MEUA693TF JCVI-MT2 Medicago truncatula cDNA 5', m... 46 3e-04 4
(EW700897) EST00637 Hemp Uni-ZAP XR cDNA library Cannabis sa... 36 3e-04 4
(CP000903) Bacillus weihenstephanensis KBAB4, complete genome. 60 3e-04 1
(CP000817) Lysinibacillus sphaericus C3-41, complete genome. 60 3e-04 1
(AM740937) Cucumis melo subsp. melo EST, clone 46d_17-C05-M13R. 38 4e-04 4
(DB646090) Saccharomyces cerevisiae mRNA, clone: S03052-42_D... 34 4e-04 5
(EE063009) C1G07220 Mixture of buds, little clusters and fru... 32 4e-04 3
(CF686293) CCAEA28TO C.neoformans strain JEC21 Cryptococcus ... 36 4e-04 4
(CF683859) CCAF544TO C.neoformans strain JEC21 Cryptococcus ... 36 4e-04 4
(FD682539) CBHX2212.fwd CBHX Mycosphaerella fijiensis MfEST4... 36 4e-04 4
(DV755525) PchrSEQ809 Phanerochaete chrysosporium pBluescrip... 42 4e-04 3
(DV753678) PchrSEQ1891 Phanerochaete chrysosporium pBluescri... 42 4e-04 3
(DV134463) CV03108B1E11.f1 CV03-normalized library Euphorbia... 38 5e-04 3
(FG586322) TpNBL014949 Trichinella pseudospiralis new born l... 50 5e-04 2
(EB019378) LscoSEQ11173 Leucosporidium scottii pBluescript (... 56 5e-04 2
(DV760789) PchrSEQ001457 Phanerochaete chrysosporium pBluesc... 42 6e-04 3
(EB021322) LscoSEQ13515 Leucosporidium scottii pBluescript (... 56 6e-04 2
(GR782387) CBWO10255.b1 CBWO Melampsora larici-populina germ... 44 6e-04 3
(DY859618) ApulSEQ12168 Aureobasidium pullulans pBluescript ... 44 6e-04 3
(DV760802) PchrSEQ005164 Phanerochaete chrysosporium pBluesc... 42 6e-04 3
(DV760791) PchrSEQ001741 Phanerochaete chrysosporium pBluesc... 42 6e-04 3
(DV760797) PchrSEQ004030 Phanerochaete chrysosporium pBluesc... 42 6e-04 3
(DV760792) PchrSEQ002289 Phanerochaete chrysosporium pBluesc... 42 7e-04 3
(EB018417) LscoSEQ10092 Leucosporidium scottii pBluescript (... 56 7e-04 2
(DV760803) PchrSEQ005226 Phanerochaete chrysosporium pBluesc... 42 7e-04 3
(DV756743) PchrSEQ5436 Phanerochaete chrysosporium pBluescri... 42 7e-04 3
(EB021482) LscoSEQ13699 Leucosporidium scottii pBluescript (... 56 7e-04 2
(DR618681) EST1008809 FvH Gibberella moniliformis cDNA clone... 46 7e-04 2
(CK275094) EST721172 potato abiotic stress cDNA library Sola... 32 7e-04 5
(EB028297) LscoSEQ8829 Leucosporidium scottii pBluescript (E... 56 7e-04 2
(CK266796) EST712874 potato abiotic stress cDNA library Sola... 32 7e-04 5
(EB010720) LedoSEQ12837 Lentinula edodes pBluescript (EcoRI-... 48 7e-04 3
(FD666867) CBHT1573.fwd CBHT Mycosphaerella fijiensis MfEST3... 44 7e-04 3
(FD667322) CBHT1825.fwd CBHT Mycosphaerella fijiensis MfEST3... 44 7e-04 3
(EB021916) LscoSEQ14245 Leucosporidium scottii pBluescript (... 56 8e-04 2
(DW489249) GH_RMIRS_074_A05_R Cotton Normalized Library rand... 46 8e-04 3
(FD678552) CBHW2266.fwd CBHW Mycosphaerella fijiensis MfEST4... 44 8e-04 3
(DW489248) GH_RMIRS_074_A05_F Cotton Normalized Library rand... 46 8e-04 3
>(BJ346257) Dictyostelium discoideum cDNA clone:dda30j10, 3' end,
single read.
Length = 755
Score = 1473 bits (743), Expect = 0.0
Identities = 746/747 (99%)
Strand = Plus / Minus
Query: 968 cgtgaaaaggaaccagagatctttgatgccatcaagtttggtgctgttttagagaatgtc 1027
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 755 cgtgaaaaggaaccagagatctttgatgccatcaagtttggtgctgttttagagaatgtc 696
Query: 1028 gtctacaatgagtactctcgtaaggtcgattacaatgatgtctctatcactgagaacacc 1087
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 695 gtctacaatgagtactctcgtaaggtcgattacaatgatgtctctatcactgagaacacc 636
Query: 1088 cgttgtgcctacccattggaacatatcccaaatgccaaattcccagctattgccggtcat 1147
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 cgttgtgcctacccattggaacatatcccaaatgccaaattcccagctattgccggtcat 576
Query: 1148 ccaaagaatatcattatgttaacttgtgatgcttttggtattctcccaccagtatctcgt 1207
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 575 ccaaagaatatcattatgttaacttgtgatgcttttggtattctcccaccagtatctcgt 516
Query: 1208 ttagatgccaatcaagttatgtaccatttcattcaaggttataccgccaaagttgccggt 1267
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 515 ttagatgccaatcaagttatgtaccatttcattcaaggttataccgccaaagctgccggt 456
Query: 1268 actgaagttggtgtcaccgaaccaactgcaaccttttcaagttgttatggtgaaccattc 1327
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 actgaagttggtgtcaccgaaccaactgcaaccttttcaagttgttatggtgaaccattc 396
Query: 1328 atcgtatggcatccaaccaaatacgctgaaatgttggcttctcaactccataaacattca 1387
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 atcgtatggcatccaaccaaatacgctgaaatgttggcttctcaactccataaacattca 336
Query: 1388 gctcgtgcttggttaattaatactggttggactggtggttctcatggtgttggttctcgt 1447
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 gctcgtgcttggttaattaatactggttggactggtggttctcatggtgttggttctcgt 276
Query: 1448 attaaattggcctacactcgtgccatcatcgatgccattcacagtggagaacttgaaaaa 1507
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 attaaattggcctacactcgtgccatcatcgatgccattcacagtggagaacttgaaaaa 216
Query: 1508 attccaaccactaaaatggatgttttcggtttccaagtaccaaatagttgtccaggtgtt 1567
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 attccaaccactaaaatggatgttttcggtttccaagtaccaaatagttgtccaggtgtt 156
Query: 1568 ccatctgaaattttaatgccaattaatggttgggctgataaagagaaatatgtttcaact 1627
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 ccatctgaaattttaatgccaattaatggttgggctgataaagagaaatatgtttcaact 96
Query: 1628 atgcataaattggctaaattatttattgaaaatttcaaaaaattccaagataaagcttca 1687
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95 atgcataaattggctaaattatttattgaaaatttcaaaaaattccaagataaagcttca 36
Query: 1688 ccagaacttgtagcagccggtccaata 1714
|||||||||||||||||||||||||||
Sbjct: 35 ccagaacttgtagcagccggtccaata 9
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 108600042
Number of Hits to DB: 1,987,621,037
Number of extensions: 107636935
Number of successful extensions: 8560879
Number of sequences better than 10.0: 1264
Length of query: 1896
Length of database: 106,710,029,556
Length adjustment: 24
Effective length of query: 1872
Effective length of database: 104,103,628,548
Effective search space: 194881992641856
Effective search space used: 194881992641856
X1: 11 (21.8 bits)
S2: 23 (46.1 bits)
Dictyostelium discoideum cDNA Project Home