Homology Contig-U10363-1 vs DNA
Query= Contig-U10363-1 (Contig-U10363-1Q) /CSM_Contig/Contig-U10363-1Q.Seq.d
(1254 letters)
Database: ddbj_A
108,600,042 sequences; 106,710,029,556 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(BJ428564) Dictyostelium discoideum cDNA clone:ddv12n10, 3' ... 1437 0.0 1
(BJ433465) Dictyostelium discoideum cDNA clone:ddv22a02, 3' ... 1209 0.0 1
(BJ433621) Dictyostelium discoideum cDNA clone:ddv22n09, 3' ... 1104 0.0 1
(BJ412584) Dictyostelium discoideum cDNA clone:ddv9i05, 5' e... 952 0.0 2
(BJ410453) Dictyostelium discoideum cDNA clone:ddv12i17, 5' ... 952 0.0 2
(BJ410411) Dictyostelium discoideum cDNA clone:ddv12n10, 5' ... 950 0.0 2
(BJ415394) Dictyostelium discoideum cDNA clone:ddv22n09, 5' ... 932 0.0 2
(BJ412325) Dictyostelium discoideum cDNA clone:ddv7m22, 5' e... 924 0.0 2
(BJ415251) Dictyostelium discoideum cDNA clone:ddv22a02, 5' ... 985 0.0 2
(BJ411089) Dictyostelium discoideum cDNA clone:ddv2p19, 5' e... 874 0.0 2
(BJ430874) Dictyostelium discoideum cDNA clone:ddv9i05, 3' e... 640 e-179 1
(BJ428617) Dictyostelium discoideum cDNA clone:ddv12i17, 3' ... 613 e-171 1
(BJ429289) Dictyostelium discoideum cDNA clone:ddv2p19, 3' e... 575 e-159 1
(CU426467) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 2e-36 5
(CU436449) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 2e-36 5
(CU425017) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 2e-36 5
(CU436253) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 2e-36 5
(CU426375) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 3e-34 5
(CU434990) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 4e-34 5
(CU434480) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 60 4e-34 5
(CU425543) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 9e-34 5
(CU435412) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 1e-33 6
(CU437913) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 1e-33 5
(CU440382) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 1e-33 5
(CU436335) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 2e-33 5
(CU425188) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 5e-32 5
(FC681911) CAXX1577.fwd CAXX Lottia gigantea from male gonad... 70 8e-31 5
(CX833033) ACAC-aaa20b11.g1 Hydra EST UCI 7 Hydra magnipapil... 56 7e-30 5
(DT614424) ACAH-aaa26f04.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 9e-30 5
(DT608952) ACAG-aab23f11.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 9e-30 5
(CV185423) taj13a02.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 56 1e-29 5
(DT619394) ACAH-aaa54c08.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 3e-29 5
(CU440515) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 6e-29 5
(CX055672) tai92g08.y2 Hydra EST UCI 5 ALP Hydra magnipapill... 56 3e-27 5
(CU441646) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 68 5e-27 4
(CJ392211) Molgula tectiformis cDNA, gonad clone:mtgd018o13,... 76 1e-26 4
(CX576158) TTE00034189 Amplicon Express - Conjugative Form T... 82 2e-26 2
(CU425532) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 66 4e-26 5
(DN636136) ACAC-aab54i14.g1 Hydra EST UCI 7 Hydra magnipapil... 54 6e-26 5
(CX830401) ACAC-aaa28d06.g1 Hydra EST UCI 7 Hydra magnipapil... 56 9e-25 4
(DT612775) ACAG-aaa16d09.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 9e-25 4
(DT611092) ACAG-aab14c04.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 9e-25 4
(DN246853) ACAE-aaa19o02.g1 Hydra EST UCI 5 Hydra magnipapil... 56 3e-24 4
(DT615969) ACAH-aab13d11.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 3e-23 4
(BP518187) Hydra magnipapillata cDNA, clone:hmp_15054. 56 4e-23 4
(DT610003) ACAG-aaa58d08.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 4e-23 4
(CX834060) ACAC-aaa61d08.g1 Hydra EST UCI 7 Hydra magnipapil... 56 4e-23 4
(CX633446) taj40g07.y3 Hydra EST UCI 5 Hydra magnipapillata ... 56 2e-22 4
(GE754165) MUS21-K12.x1d-t SHGC-MUS Mytilus californianus cD... 66 6e-22 4
(CV185373) taj12c10.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 56 2e-21 4
(CX834824) ACAC-aaa47f08.g1 Hydra EST UCI 7 Hydra magnipapil... 56 2e-21 4
(AM890641) Nyctotherus ovalis GSS, clone HK252. 60 3e-19 4
(DT605936) ACAH-aaa78b05.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 5e-19 3
(DT614063) ACAH-aaa42f10.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 7e-19 3
(CO511087) tai55h08.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 56 7e-19 3
(CO510942) tai53d11.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 56 7e-19 3
(DT613098) ACAG-aaa70h07.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 7e-19 3
(DT608715) ACAG-aaa28a03.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 7e-19 3
(DN137649) ACAE-aaa07e02.g1 Hydra EST UCI 5 Hydra magnipapil... 56 8e-19 3
(CX634131) taj46g07.y3 Hydra EST UCI 5 Hydra magnipapillata ... 56 8e-19 3
(DN816369) ACAC-aab98a10.g1 Hydra EST UCI 7 Hydra magnipapil... 56 8e-19 3
(DN240313) ACAC-aaa30b07.g1 Hydra EST UCI 7 Hydra magnipapil... 56 8e-19 3
(DR434950) ACAB-aaa21d10.g1 Hydra UCI6- barcoded EST's Hydra... 56 8e-19 3
(CB887602) Lice_02_J14_T3 Body louse cDNA library Pediculus ... 100 8e-19 2
(DN813845) ACAC-aab58g08.g1 Hydra EST UCI 7 Hydra magnipapil... 56 8e-19 3
(DT620113) ACAH-aaa18f01.g1 Hydra_EST_UCI-10 Hydra magnipapi... 56 8e-19 3
(CX835398) ACAC-aaa09c08.g1 Hydra EST UCI 7 Hydra magnipapil... 56 8e-19 3
(BP507491) Hydra magnipapillata cDNA, clone:hmp_01041. 56 9e-19 3
(GR201078) CBPI4472.b1 CBPI Mimulus lewisii floral buds (L) ... 60 5e-18 4
(AM535949) Paracentrotus lividus EST, clone MPMGp1171I08210Q... 62 9e-18 4
(AM530636) Paracentrotus lividus EST, clone MPMGp1171H0165Q,... 62 1e-17 4
(CV042241) tai53d11.y2 Hydra EST UCI 5 ALP Hydra magnipapill... 56 4e-17 3
(FC820190) Sr_pAMT7_016p19_T7 S. ratti mixed stage pAMP Stro... 48 1e-16 6
(CU432992) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 60 2e-16 4
(DT611656) ACAG-aaa90e10.g1 Hydra_EST_UCI-9 Hydra magnipapil... 56 7e-16 3
(AM225038) Paracentrotus lividus EST, clone MPMGp1174P0355Q,... 62 2e-15 4
(AM208765) Paracentrotus lividus EST, clone MPMGp1174C2016Q,... 62 2e-15 4
(BW642817) Dugesia ryukyuensis mRNA, clone: Dr_sW_025_I16, 5... 70 2e-15 4
(AM530931) Paracentrotus lividus EST, clone MPMGp1171I0966Q,... 62 2e-15 4
(AM207804) Paracentrotus lividus EST, clone MPMGp1174G1813Q,... 62 2e-15 4
(AM201917) Paracentrotus lividus EST, clone MPMGp1172D0953Q,... 70 4e-15 4
(FF422766) G125P60069RF6.T0 Acorn worm blastula/gastrula pCM... 60 6e-15 3
(AM193355) Paracentrotus lividus EST, clone MPMGp1172P0331Q,... 62 6e-15 4
(FK925271) EST_lsal_evj_958694 lsalevj mixed_tissue_mixed_st... 62 7e-15 4
(AM194575) Paracentrotus lividus EST, clone MPMGp1172F2135Q,... 62 7e-15 4
(EY506858) EST_lsal_af_800467 lsalaf whole Lepeophtheirus sa... 62 8e-15 4
(EX485031) EST_lsal_evj_795464 lsalevj mixed_tissue_mixed_st... 62 8e-15 4
(EY506707) EST_lsal_af_786000 lsalaf whole Lepeophtheirus sa... 62 8e-15 4
(FF423767) G125P60086RB2.T0 Acorn worm blastula/gastrula pCM... 60 8e-15 3
(AM558777) Paracentrotus lividus EST, clone MPMGp1172O0566Q,... 62 9e-15 5
(EY509139) EST_lsal_pf_787933 lsalpf whole Lepeophtheirus sa... 62 9e-15 4
(AM557991) Paracentrotus lividus EST, clone MPMGp1172M1464Q,... 62 9e-15 4
(EY506601) EST_lsal_af_785826 lsalaf whole Lepeophtheirus sa... 62 1e-14 4
(DN313686) PL06016A2C06 cDNA from juvenile hermaphodites Sch... 62 1e-14 3
(FM980549) Glossina morsitans morsitans EST, clone GMsg154g0... 80 1e-14 3
(AR548754) Sequence 3885 from patent US 6747137. 52 2e-14 3
(AM558768) Paracentrotus lividus EST, clone MPMGp1172N2066Q,... 62 2e-14 4
(CJ395444) Molgula tectiformis cDNA, gonad clone:mtgd025h03,... 76 3e-14 2
(AM523820) Paracentrotus lividus EST, clone MPMGp1171N1229Q,... 62 3e-14 3
(CJ396127) Molgula tectiformis cDNA, gonad clone:mtgd027g18,... 76 3e-14 2
(CJ389209) Molgula tectiformis cDNA, gonad clone:mtgd010a17,... 76 3e-14 2
(CJ419019) Molgula tectiformis cDNA, larva clone:mtlv032d22,... 76 3e-14 2
(BT078097) Lepeophtheirus salmonis Pacific form clone lsal-e... 62 4e-14 4
(DN928244) 4153718 BARC_3GAL chicken mixed tissue Gallus gal... 70 1e-13 2
(CN218595) RJA032H10.ab1 RJbrain Gallus gallus cDNA 5', mRNA... 70 2e-13 2
(AM524739) Paracentrotus lividus EST, clone MPMGp1171N0145Q,... 62 2e-13 4
(FK932998) EST_lsal_evj_944253 lsalevj mixed_tissue_mixed_st... 62 2e-13 3
(AM521208) Paracentrotus lividus EST, clone MPMGp1171N089Q, ... 62 2e-13 4
(AM210587) Paracentrotus lividus EST, clone MPMGp1174M231Q, ... 62 3e-13 4
(EL760172) AD0137005 Taenia solium UNAM-cd1_adult Taenia sol... 74 3e-13 3
(AM200084) Paracentrotus lividus EST, clone MPMGp1172E0449Q,... 62 3e-13 4
(AM541082) Paracentrotus lividus EST, clone MPMGp1171B0572Q,... 62 3e-13 4
(BW639756) Dugesia ryukyuensis mRNA, clone: Dr_sW_015_O21, 5... 70 3e-13 4
(AM196407) Paracentrotus lividus EST, clone MPMGp1172E183Q, ... 62 4e-13 4
(BG226357) kq20f05.y1 TBN95TM-SSR Strongyloides stercoralis ... 56 4e-13 3
(EL762979) AD0196032 Taenia solium UNAM-cd1_adult Taenia sol... 74 4e-13 3
(BW636871) Dugesia ryukyuensis mRNA, clone: Dr_sW_006_M09, 5... 70 5e-13 4
(FK922613) EST_lsal_evj_937363 lsalevj mixed_tissue_mixed_st... 56 5e-13 4
(BU252035) 603404043F1 CSEQCHN35 Gallus gallus cDNA clone Ch... 68 6e-13 2
(CK543368) rswhb0_010164.y1 swh Bombyx mori cDNA, mRNA seque... 62 8e-13 3
(FE140397) LV_HP_RA37O11r Litopenaeus vannamei hepatopancrea... 42 9e-13 4
(FE074332) LV_GL_RA04I19r Litopenaeus vannamei gills cDNA li... 42 1e-12 4
(FE162772) LV_LO_RA032C02r Litopenaeus vannamei lymphoid org... 42 1e-12 4
(FE155252) LV_LO_RA016F05r Litopenaeus vannamei lymphoid org... 42 1e-12 4
(FE077465) LV_GL_RA12K10r Litopenaeus vannamei gills cDNA li... 42 1e-12 4
(FF465308) G50P6268RA10.T0 Acorn worm gastrula/neurula pCMVS... 60 1e-12 3
(FF450729) G178P60131RD10.T0 Acorn worm gastrula/neurula pCM... 60 1e-12 3
(FE083636) LV_GL_RA24G18r Litopenaeus vannamei gills cDNA li... 42 1e-12 4
(CJ349254) Molgula tectiformis cDNA, cleaving embryo clone:m... 52 1e-12 4
(FF480573) G613P6228RB8.T0 Acorn worm blastula/gastrula pCMV... 60 2e-12 3
(FF447014) G178P60080RE10.T0 Acorn worm gastrula/neurula pCM... 60 2e-12 3
(FF451645) G178P60144RA10.T0 Acorn worm gastrula/neurula pCM... 60 2e-12 3
(EX936380) li30a02.g7 Ginkgo male leaf (NYBG) Ginkgo biloba ... 70 2e-12 2
(FF651165) G826P5240RD5.T0 Acorn worm normalized juvenile pE... 60 2e-12 3
(BT099048) Soybean clone JCVI-FLGm-23H5 unknown mRNA. 52 2e-12 4
(FF475198) G613P6130RH3.T0 Acorn worm blastula/gastrula pCMV... 60 2e-12 3
(FF473604) G613P6102RH10.T0 Acorn worm blastula/gastrula pCM... 60 2e-12 3
(AM194919) Paracentrotus lividus EST, clone MPMGp1172E1536Q,... 56 2e-12 3
(CJ399720) Molgula tectiformis cDNA, gonad clone:mtgd010a17,... 52 2e-12 4
(CK312130) SB02011A1B10.f1 normalized Keck-Tagu Library SB02... 58 2e-12 2
(AM553612) Paracentrotus lividus EST, clone MPMGp1172N20110Q... 62 4e-12 4
(DN250950) ACAB-aab19g04.g1 Hydra UCI6- barcoded EST's Hydra... 56 4e-12 2
(FC741325) CBBI12404.fwd CBBI Lottia gigantea 26h,37h,61h La... 50 4e-12 4
(DN250453) ACAB-aab87d24.g1 Hydra UCI6- barcoded EST's Hydra... 56 5e-12 2
(DN253273) ACAC-aac36b06.g1 Hydra EST UCI 7 Hydra magnipapil... 56 5e-12 2
(CX634616) taj52g06.y3 Hydra EST UCI 5 Hydra magnipapillata ... 56 5e-12 2
(CV223331) taj60h01.y1 Hydra EST UCI 6 Hydra magnipapillata ... 56 6e-12 2
(CJ402819) Molgula tectiformis cDNA, gonad clone:mtgd018o13,... 52 6e-12 4
(CN566064) taf90e08.x1 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 7e-12 3
(BT014448) Lycopersicon esculentum clone 133774F, mRNA seque... 66 8e-12 4
(DN301314) PL04022A1G11 cDNA from sexually mature hermaphodi... 52 9e-12 3
(AM223206) Paracentrotus lividus EST, clone MPMGp1174B2151Q,... 62 1e-11 3
(DN310628) PL06007B2H04 cDNA from juvenile hermaphodites Sch... 52 1e-11 3
(DN309989) PL06006A1H07 cDNA from juvenile hermaphodites Sch... 52 1e-11 3
(DN296038) PL04004X1A05 cDNA from sexually mature hermaphodi... 52 1e-11 3
(DN314645) PL06018B2E11 cDNA from juvenile hermaphodites Sch... 52 1e-11 3
(AL653595) Xenopus tropicalis EST, clone TGas041d16 5'. 44 1e-11 5
(CZ285957) cp44c07.r Candida parapsilosis Random Genomic Lib... 44 2e-11 4
(AM189120) Paracentrotus lividus EST, clone MPMGp1172E1621Q,... 62 3e-11 3
(FE345473) CBIB495.fwd CBIB_Daphnia_pulex_Chosen_One_Library... 66 3e-11 2
(AM559849) Paracentrotus lividus EST, clone MPMGp1172M1769Q,... 62 4e-11 3
(GR840632) CCCC11387.b1 CCCC Glycine max callus grown in dar... 48 4e-11 4
(AM558021) Paracentrotus lividus EST, clone MPMGp1172N2064Q,... 62 4e-11 3
(EY590294) CAWU21581.fwd CAWU Capitella sp. I ECS-2004 Prima... 50 5e-11 3
(EY601227) CAWU5956.fwd CAWU Capitella sp. I ECS-2004 Primar... 50 5e-11 3
(AM516127) Paracentrotus lividus EST, clone MPMGp1171J2125Q,... 54 5e-11 4
(AW618294) EST314344 L. pennellii trichome, Cornell Universi... 82 6e-11 1
(EY188823) LLAE0451S Spider Loxosceles laeta cDNA library Lo... 82 6e-11 1
(EV277155) GLMD119TF JCVI-SOY2 Glycine max cDNA 5', mRNA seq... 48 6e-11 4
(CK721979) tad44e08.y2 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 6e-11 3
(EL760182) AD0137015 Taenia solium UNAM-cd1_adult Taenia sol... 74 7e-11 2
(AM516099) Paracentrotus lividus EST, clone MPMGp1171F1325Q,... 62 7e-11 4
(CX472417) JGI_XZG5547.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 8e-11 4
(CJ387810) Molgula tectiformis cDNA, gonad clone:mtgd001h09,... 76 9e-11 2
(AF549919) Xenopus laevis clone S10-40-D11 mRNA sequence. 52 1e-10 3
(DN154771) 3002_Xenopus laevis oocyte cDNA subtracted librar... 52 1e-10 3
(DN154772) 3006_Xenopus laevis oocyte cDNA subtracted librar... 52 1e-10 3
(CX135196) AGENCOURT_39737818 NICHD_XGC_Te2N Xenopus laevis ... 52 1e-10 3
(EB466840) AGENCOURT_73510107 NICHD_XGC_sple_PHA Xenopus lae... 52 2e-10 3
(CA793944) AGENCOURT_11044406 NICHD_XGC_Emb1 Xenopus laevis ... 52 2e-10 3
(CA790392) AGENCOURT_10301512 NICHD_XGC_Emb1 Xenopus laevis ... 52 2e-10 3
(BX566578) Glossina morsitans morsitans (Tseatse fly) EST fr... 80 2e-10 1
(BX551526) Glossina morsitans morsitans (Tseatse fly) EST fr... 80 2e-10 1
(BX551511) Glossina morsitans morsitans (Tseatse fly) EST fr... 80 2e-10 1
(FM975058) Glossina morsitans morsitans EST, clone GMsg76a10... 80 2e-10 1
(FM974321) Glossina morsitans morsitans EST, clone GMsg91e02... 80 2e-10 1
(FM968575) Glossina morsitans morsitans EST, clone GMsg67d09... 80 2e-10 1
(ES736166) MytUSCGMHMa4pTrueBlue11m03f1 Mytilus californianu... 66 3e-10 2
(BT095661) Soybean clone JCVI-FLGm-19P7 unknown mRNA. 48 3e-10 4
(ES565008) TPAF-aab33h06.g1 T.spiralis_EST Trichinella spira... 64 4e-10 3
(ES392825) MUS04-F09.x1d-t SHGC-MUS Mytilus californianus cD... 42 4e-10 4
(AM203966) Paracentrotus lividus EST, clone MPMGp1172L2058Q,... 62 4e-10 3
(ES563412) TPAF-aab57g03.g1 T.spiralis_EST Trichinella spira... 64 4e-10 3
(BU723399) SJMAVH12 SJM Schistosoma japonicum cDNA similar t... 56 5e-10 3
(BU797721) SJF2EQB09 SJF Schistosoma japonicum cDNA similar ... 56 5e-10 3
(CK242735) EST726372 potato callus cDNA library, normalized ... 78 5e-10 2
(ES562867) TPAF-aab11b06.g1 T.spiralis_EST Trichinella spira... 64 5e-10 3
(DV627057) 97605.1 Cold Sweetening C Solanum tuberosum cDNA ... 78 5e-10 2
(EH223548) JGI_ABWZ4307.fwd ABWZ Phakopsora pachyrhizi infec... 52 6e-10 4
(CK247024) EST730661 potato callus cDNA library, normalized ... 78 6e-10 2
(FE146207) LV_HP_RA50H21r Litopenaeus vannamei hepatopancrea... 42 6e-10 4
(CK250055) EST733692 potato callus cDNA library, normalized ... 78 6e-10 2
(CK249559) EST733196 potato callus cDNA library, normalized ... 78 6e-10 2
(CK246169) EST729806 potato callus cDNA library, normalized ... 78 6e-10 2
(CK242736) EST726373 potato callus cDNA library, normalized ... 78 6e-10 2
(CK242869) EST726506 potato callus cDNA library, normalized ... 78 6e-10 2
(CK247920) EST731557 potato callus cDNA library, normalized ... 78 6e-10 2
(ES598041) TINM-P12_C06 Triatoma infestans salivary gland cD... 66 6e-10 2
(CK255638) EST739275 potato callus cDNA library, normalized ... 78 6e-10 2
(CK246582) EST730219 potato callus cDNA library, normalized ... 78 6e-10 2
(CK252491) EST736128 potato callus cDNA library, normalized ... 78 6e-10 2
(CK276989) EST723067 potato abiotic stress cDNA library Sola... 78 6e-10 2
(CK247587) EST731224 potato callus cDNA library, normalized ... 78 6e-10 2
(CK242868) EST726505 potato callus cDNA library, normalized ... 78 7e-10 2
(FK022189) GLRA568TF JCVI-SOY3 Glycine max cDNA 5', mRNA seq... 52 7e-10 4
(EU020681) Speleonectes tulumensis clone Stu3059f1 putative ... 44 7e-10 4
(DN743623) 94308.1 Full Length Mixed Tuber Solanum tuberosum... 78 1e-09 1
(BY893500) Cryptomeria japonica cDNA clone: CMFL043_M04, 5'e... 78 1e-09 1
(BQ482581) ke51d01.y1 Dirofilaria immitis adult SL1 TOPO v1 ... 78 1e-09 1
(BI177797) EST518742 cSTE Solanum tuberosum cDNA clone cSTE1... 78 1e-09 1
(BG096761) EST461280 potato leaves and petioles Solanum tube... 78 1e-09 1
(AK326410) Solanum lycopersicum cDNA, clone: LEFL2006K04, HT... 58 1e-09 4
(AM201813) Paracentrotus lividus EST, clone MPMGp1172O2252Q,... 62 1e-09 3
(AM521224) Paracentrotus lividus EST, clone MPMGp1171P169Q, ... 62 1e-09 3
(AM514489) Paracentrotus lividus EST, clone MPMGp1171P1418Q,... 62 2e-09 3
(EX295216) 1608909_5_F03_012 PY06 Carica papaya cDNA, mRNA s... 68 2e-09 2
(CV476554) 25321.1 Developing Tubers Solanum tuberosum cDNA ... 58 2e-09 3
(AM903613) Carica papaya EST, clone Cpap_002F02.g_006.ab1. 68 2e-09 2
(AM533939) Paracentrotus lividus EST, clone MPMGp1171M2367Q,... 62 2e-09 3
(DV974419) GQ027110.B3_F10 GQ099: Mixed spruce tissues Picea... 62 2e-09 2
(EX433369) GQ03913.B7_C17 GQ039 - Stem - Dormant Picea glauc... 62 2e-09 2
(GE481107) GQ0202.B3.r_O09 GQ020: Clean ROOTS systems -Diurn... 62 2e-09 2
(EX343793) GQ03102.B7.1_A03 GQ031 - Xylem Scrapings (Normali... 62 2e-09 2
(CT791678) Paramecium tetraurelia 5-PRIME EST from clone LK0... 58 2e-09 2
(CT762689) Paramecium tetraurelia 5-PRIME EST from clone LK0... 58 2e-09 2
(AM200587) Paracentrotus lividus EST, clone MPMGp1172K014Q, ... 64 2e-09 3
(DV986303) GQ0202.B3_O09 GQ020: Clean ROOTS systems -Diurnal... 62 2e-09 2
(EY997852) CATH5703.rev CATH Sporobolomyces roseus IAM 13481... 52 2e-09 2
(EX344166) GQ03102.B7_A03 GQ031 - Xylem Scrapings (Normalize... 62 2e-09 2
(EX308310) GQ01307.T3_L02 GQ013 - Elongating ROOTS tips - sa... 62 2e-09 2
(EX259762) 1439926_5_A04_016 PY06 Carica papaya cDNA, mRNA s... 68 2e-09 2
(EX265542) 1445810_5_F08_028 PY06 Carica papaya cDNA, mRNA s... 68 3e-09 2
(CT782431) Paramecium tetraurelia 5-PRIME EST from clone LK0... 58 3e-09 2
(EX264603) 1445049_5_F15_060 PY06 Carica papaya cDNA, mRNA s... 68 3e-09 2
(EX274487) 1455350_5_C20_078 PY06 Carica papaya cDNA, mRNA s... 68 3e-09 2
(EX268264) 1448692_5_N10_035 PY06 Carica papaya cDNA, mRNA s... 68 3e-09 2
(EX261504) 1442153_5_M23_084 PY06 Carica papaya cDNA, mRNA s... 68 3e-09 2
(BG364944) dc93g01.y1 NICHD_XGC_OO1 Xenopus laevis cDNA clon... 52 3e-09 3
(CX770982) ACAD-aaa30h10.g1 Hydra_EST_UCI-8 Hydra magnipapil... 54 3e-09 2
(EB131777) 020805AVBC011695HT (AVBC) Royal Gala young shoot ... 50 5e-09 3
(AL956929) Xenopus tropicalis EST, clone TGas125d06 5'. 44 5e-09 4
(AL968806) Xenopus tropicalis EST, clone TGas137h07 5'. 44 5e-09 4
(AL787483) Xenopus tropicalis EST, clone TNeu114e14 5'. 44 6e-09 4
(AW035708) EST281862 tomato callus, TAMU Solanum lycopersicu... 74 6e-09 2
(BY916602) Bombyx mori cDNA, clone:n0177, 5' end sequence. 62 6e-09 2
(AL661206) Xenopus tropicalis EST, clone TNeu041d05 5'. 44 6e-09 4
(AW033007) EST276566 tomato callus, TAMU Solanum lycopersicu... 74 6e-09 2
(AL864551) Xenopus tropicalis EST, clone TEgg116g11 5'. 44 6e-09 4
(AL786703) Xenopus tropicalis EST, clone TNeu096o22 5'. 44 6e-09 4
(BQ391516) NISC_mq19b10.y1 NICHD_XGC_Emb5 Xenopus (Silurana)... 44 6e-09 4
(BQ389261) NISC_mq06e11.y1 NICHD_XGC_Emb5 Xenopus (Silurana)... 44 7e-09 4
(AL858159) Xenopus tropicalis EST, clone TEgg074l08 5'. 44 7e-09 4
(CX477943) JGI_XZG20950.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 7e-09 4
(AL640561) Xenopus tropicalis EST, clone TNeu004o13 5'. 44 7e-09 4
(AL646937) Xenopus tropicalis EST, clone TGas030g09 5'. 44 7e-09 4
(AL774771) Xenopus tropicalis EST, clone TGas079b19 5'. 44 7e-09 4
(BQ395896) NISC_ng17g07.y1 NICHD_XGC_Emb6 Xenopus (Silurana)... 44 7e-09 4
(AL649506) Xenopus tropicalis EST, clone TGas049l03 5'. 44 7e-09 4
(AL594409) Xenopus tropicalis EST, clone TGas005f22 5'. 44 7e-09 4
(AL652639) Xenopus tropicalis EST, clone TGas027p20 5'. 44 7e-09 4
(AL631497) Xenopus tropicalis EST, clone TGas019g23 5'. 44 7e-09 4
(AL593990) Xenopus tropicalis EST, clone TGas004k12 5'. 44 7e-09 4
(BI930623) EST550512 tomato flower, 8 mm to preanthesis buds... 74 7e-09 2
(CR427722) Xenopus tropicalis EST, clone TTbA044k13 5'. 44 7e-09 4
(AL628048) Xenopus tropicalis EST, clone TGas022m17 5'. 44 7e-09 4
(AL630743) Xenopus tropicalis EST, clone TGas014h15 5'. 44 7e-09 4
(DC185301) Xenopus (Silurana) tropicalis NBRP cDNA clone: st... 44 7e-09 4
(AL660417) Xenopus tropicalis EST, clone TNeu044m01 5'. 44 7e-09 4
(AL630860) Xenopus tropicalis EST, clone TGas014m04 5'. 44 7e-09 4
(CX480438) JGI_XZG1189.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 8e-09 4
(CX478032) JGI_XZG20999.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(CX459546) JGI_XZG28225.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(AL642973) Xenopus tropicalis EST, clone TNeu016k12 5'. 44 8e-09 4
(AL660031) Xenopus tropicalis EST, clone TNeu040a23 5'. 44 8e-09 4
(AL635409) Xenopus tropicalis EST, clone TNeu007b17 5'. 44 8e-09 4
(DC169889) Xenopus (Silurana) tropicalis NBRP cDNA clone: st... 44 8e-09 4
(AL630937) Xenopus tropicalis EST, clone TGas014l04 5'. 44 8e-09 4
(DC165714) Xenopus (Silurana) tropicalis NBRP cDNA clone: st... 44 8e-09 4
(AM533242) Paracentrotus lividus EST, clone MPMGp1171F0970Q,... 62 8e-09 3
(EX443219) GQ04107.B7_K17 GQ041 - Shoot tip - Dormant (Norma... 60 8e-09 2
(CX431332) JGI_XZG62114.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(CX419841) JGI_XZG14694.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(BI930618) EST550507 tomato flower, 8 mm to preanthesis buds... 74 8e-09 2
(CX401972) JGI_XZT49535.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 8e-09 4
(AM530461) Paracentrotus lividus EST, clone MPMGp1171J0864Q,... 62 8e-09 3
(DC167772) Xenopus (Silurana) tropicalis NBRP cDNA clone: st... 44 8e-09 4
(CX420941) JGI_XZG15350.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(CX462681) JGI_XZG25484.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(CR446949) Xenopus tropicalis EST, clone TTbA080h03 5'. 44 8e-09 4
(CX463303) JGI_XZG25858.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(CX477379) JGI_XZG20628.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 8e-09 4
(ES676510) CCAX2967.b1 NICHD_XGC_tropEye1 Xenopus (Silurana)... 44 9e-09 4
(CX461942) JGI_XZG25039.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 9e-09 4
(CX428340) JGI_XZG18698.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 9e-09 4
(EH015774) USDA-FP_188341 Lysiphlebus testaceipes adult whol... 46 9e-09 4
(CX443057) JGI_XZG8698.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 9e-09 4
(CX460484) JGI_XZG28763.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 9e-09 4
(FL687707) KLYLCD001_01-A12 Deschampsia antarctica Greenhous... 44 9e-09 3
(DT393278) JGI_CABH9786.rev NIH_XGC_tropSkeMus1 Xenopus (Sil... 44 9e-09 4
(CX419507) JGI_XZG14047.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 9e-09 4
(CR561078) Xenopus tropicalis EST, clone THdA007d22 5'. 44 9e-09 4
(CF149364) AGENCOURT_14929414 NICHD_XGC_Emb7 Xenopus (Silura... 44 9e-09 4
(AL629408) Xenopus tropicalis EST, clone TGas017m06 5'. 44 9e-09 4
(EL826345) CBWN8938.b1 NICHD_XGC_tropTe1 Xenopus (Silurana) ... 44 9e-09 4
(CX476982) JGI_XZG20393.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 9e-09 4
(AL632027) Xenopus tropicalis EST, clone TGas015n18 5'. 44 1e-08 4
(AL644193) Xenopus tropicalis EST, clone TNeu026k07 5'. 44 1e-08 4
(EL823898) CBWN7397.b1 NICHD_XGC_tropTe1 Xenopus (Silurana) ... 44 1e-08 4
(CX426866) JGI_XZG13601.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX479221) JGI_XZG444.fwd NIH_XGC_tropGas7 Xenopus (Silurana... 44 1e-08 4
(CR565571) Xenopus tropicalis EST, clone THdA012d23 5'. 44 1e-08 4
(AL633649) Xenopus tropicalis EST, clone TGas017g15 5'. 44 1e-08 4
(CF149080) AGENCOURT_14928193 NICHD_XGC_Emb7 Xenopus (Silura... 44 1e-08 4
(FL687384) KLYLCD001_01-A09 Deschampsia antarctica Greenhous... 44 1e-08 3
(CX473227) JGI_XZG6015.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(CX432213) JGI_XZG62628.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX479997) JGI_XZG926.fwd NIH_XGC_tropGas7 Xenopus (Silurana... 44 1e-08 4
(FL687401) KLYLCD001_03-H05 Deschampsia antarctica Greenhous... 44 1e-08 3
(BG513091) dc96g09.y1 NICHD_XGC_OO1 Xenopus laevis cDNA clon... 44 1e-08 3
(DT426942) JGI_CABJ6631.fwd NIH_XGC_tropSki1 Xenopus (Silura... 44 1e-08 4
(CX418593) JGI_XZG65632.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CR563409) Xenopus tropicalis EST, clone THdA012d24 5'. 44 1e-08 4
(CF221048) AGENCOURT_14995776 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(EL710498) CBSU7639.fwd NICHD_XGC_tropLimb_m Xenopus (Silura... 44 1e-08 4
(CX425021) JGI_XZG11989.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX487767) JGI_XZG29885.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX421187) JGI_XZG15500.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(EL844468) CBXT4972.b1 NICHD_XGC_trop_25 Xenopus (Silurana) ... 44 1e-08 4
(CX506822) JGI_XZG51881.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF785545) AGENCOURT_15941071 XtSt10-30 Xenopus (Silurana) t... 44 1e-08 4
(CX794329) JGI_CAAJ6368.fwd NIH_XGC_tropBrn2 Xenopus (Silura... 44 1e-08 4
(CR584802) Xenopus tropicalis EST, clone THdA048i11 5'. 44 1e-08 4
(CX412093) JGI_XZT28795.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(DT438813) JGI_CABK2297.fwd NIH_XGC_tropSpl1 Xenopus (Silura... 44 1e-08 4
(DN003253) JGI_CAAQ4552.fwd NIH_XGC_tropHrt1 Xenopus (Silura... 44 1e-08 4
(CF222012) AGENCOURT_14994494 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CX442728) JGI_XZG8354.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(GO081488) PmTwN07B08_Seeing_1st_500 PmTwN Penaeus monodon c... 42 1e-08 4
(DN091719) JGI_CABE4404.fwd NIH_XGC_tropOva1 Xenopus (Silura... 44 1e-08 4
(EL849733) CBXT8189.g3 NICHD_XGC_trop_25 Xenopus (Silurana) ... 44 1e-08 4
(CX489525) JGI_XZG32725.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF221248) AGENCOURT_14995274 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CX438795) JGI_XZG6847.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(DT412352) JGI_CABI11280.fwd NIH_XGC_tropOvi1 Xenopus (Silur... 44 1e-08 4
(CR579974) Xenopus tropicalis EST, clone THdA033n06 5'. 44 1e-08 4
(CX312307) JGI_XZT11862.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CF221381) AGENCOURT_14993905 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(GQ375902) Echinococcus granulosus arginine N-methyltransfer... 58 1e-08 3
(CX465206) JGI_XZG46912.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CR424462) Xenopus tropicalis EST, clone TTbA016c19 5'. 44 1e-08 4
(DT394267) JGI_CABH10320.fwd NIH_XGC_tropSkeMus1 Xenopus (Si... 44 1e-08 4
(CR571725) Xenopus tropicalis EST, clone THdA019m24 5'. 44 1e-08 4
(CX499851) JGI_XZG31420.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX432077) JGI_XZG62551.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX419402) JGI_XZG13934.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX418087) JGI_XZG65336.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX393962) JGI_XZT26601.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX497336) JGI_XZG43479.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(DT438279) JGI_CABK2013.fwd NIH_XGC_tropSpl1 Xenopus (Silura... 44 1e-08 4
(CF218817) AGENCOURT_14971913 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CR588871) Xenopus tropicalis EST, clone THdA051g07 5'. 44 1e-08 4
(BG552750) dab75d11.y1 NICHD_XGC_Emb4 Xenopus laevis cDNA cl... 44 1e-08 3
(CX511106) JGI_XZG36444.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX492446) JGI_XZG38783.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(BG893130) daa88e11.y1 Wellcome CRC pRN3 St13 17 egg animal ... 44 1e-08 3
(CX504428) JGI_XZG41371.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX447345) JGI_XZG22546.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX421478) JGI_XZG15676.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF217419) AGENCOURT_14972516 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CR410190) Xenopus tropicalis EST, clone TTbA011f19 5'. 44 1e-08 4
(CX507640) JGI_XZG52368.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX497693) JGI_XZG43683.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX442897) JGI_XZG8532.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(CX503398) JGI_XZG40768.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX496506) JGI_XZG42622.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX417088) JGI_XZG64755.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF222786) AGENCOURT_14926859 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(DN001043) JGI_CAAQ3292.fwd NIH_XGC_tropHrt1 Xenopus (Silura... 44 1e-08 4
(CX366937) JGI_XZT30465.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CF219132) AGENCOURT_14971804 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(DT410575) JGI_CABI10289.rev NIH_XGC_tropOvi1 Xenopus (Silur... 44 1e-08 4
(DN065526) JGI_CABD2435.fwd NIH_XGC_tropLun1 Xenopus (Silura... 44 1e-08 4
(CX436580) JGI_XZG59207.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF220524) AGENCOURT_15041107 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(DT392027) JGI_CABH9105.fwd NIH_XGC_tropSkeMus1 Xenopus (Sil... 44 1e-08 4
(CX960037) JGI_CAAO10641.fwd NIH_XGC_tropTe5 Xenopus (Silura... 44 1e-08 4
(CR575709) Xenopus tropicalis EST, clone THdA040g14 5'. 44 1e-08 4
(CF148573) AGENCOURT_14927809 NICHD_XGC_Emb7 Xenopus (Silura... 44 1e-08 4
(CX432212) JGI_XZG62628.rev NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(DN088389) JGI_CABE2268.fwd NIH_XGC_tropOva1 Xenopus (Silura... 44 1e-08 4
(DT440867) JGI_CABK3424.rev NIH_XGC_tropSpl1 Xenopus (Silura... 44 1e-08 4
(CX444305) JGI_XZG10310.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX503503) JGI_XZG40829.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX321402) JGI_XZT13204.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CR436648) Xenopus tropicalis EST, clone TTbA051p05 5'. 44 1e-08 4
(CF222058) AGENCOURT_14994030 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CR435289) Xenopus tropicalis EST, clone TTbA041l03 5'. 44 1e-08 4
(CF217252) AGENCOURT_14970696 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(DR846399) JGI_CABE10884.fwd NIH_XGC_tropOva1 Xenopus (Silur... 44 1e-08 4
(CX424040) JGI_XZG63890.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(BG364268) dc91g04.y1 NICHD_XGC_OO1 Xenopus laevis cDNA clon... 44 1e-08 3
(CF219136) AGENCOURT_14971744 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(BG555741) df20g01.x1 Wellcome CRC pRN3 St13 17 egg animal c... 44 1e-08 3
(DN088473) JGI_CABE2310.fwd NIH_XGC_tropOva1 Xenopus (Silura... 44 1e-08 4
(DN066706) JGI_CABD3478.fwd NIH_XGC_tropLun1 Xenopus (Silura... 44 1e-08 4
(CX500732) JGI_XZG31926.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX485994) JGI_XZG35102.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CR420775) Xenopus tropicalis EST, clone TTbA024j20 5'. 44 1e-08 4
(CX504315) JGI_XZG41303.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX497570) JGI_XZG43610.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX474563) JGI_XZG49436.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX457797) JGI_XZG54440.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(DN096508) JGI_CABE6915.fwd NIH_XGC_tropOva1 Xenopus (Silura... 44 1e-08 4
(CX492281) JGI_XZG38691.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX466946) JGI_XZG47905.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX489405) JGI_XZG32656.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CR423998) Xenopus tropicalis EST, clone TTbA034c19 5'. 44 1e-08 4
(CX444477) JGI_XZG10467.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF222441) AGENCOURT_15066282 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CF220546) AGENCOURT_15041089 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CF217584) AGENCOURT_14972396 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(CX851009) JGI_CAAL7609.fwd NIH_XGC_tropBrn4 Xenopus (Silura... 44 1e-08 4
(CX849906) JGI_CAAL6586.fwd NIH_XGC_tropBrn4 Xenopus (Silura... 44 1e-08 4
(CX388676) JGI_XZT37069.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX343778) JGI_XZT23100.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX502133) JGI_XZG40037.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(BX732127) Xenopus tropicalis EST, clone TTpA033b18 5'. 44 1e-08 4
(BG814651) daf69h09.y1 NICHD_XGC_Eye1 Xenopus laevis cDNA cl... 44 1e-08 3
(CX494986) JGI_XZG37342.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX498161) JGI_XZG43956.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX463567) JGI_XZG45963.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX438018) JGI_XZG6395.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(CX312190) JGI_XZT11784.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX484652) JGI_XZG34326.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF590102) AGENCOURT_15681186 NICHD_XGC_Swb1N Xenopus (Silur... 44 1e-08 4
(CX472028) JGI_XZG5328.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(DR850366) JGI_CABE12969.fwd NIH_XGC_tropOva1 Xenopus (Silur... 44 1e-08 4
(DN096461) JGI_CABE6891.fwd NIH_XGC_tropOva1 Xenopus (Silura... 44 1e-08 4
(CX508988) JGI_XZG53147.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX385752) JGI_XZT65128.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX468101) JGI_XZG48599.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX509654) JGI_XZG35583.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX497482) JGI_XZG43560.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX490187) JGI_XZG33107.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CR415196) Xenopus tropicalis EST, clone TTbA005p03 5'. 44 1e-08 4
(CF224465) AGENCOURT_15069704 NICHD_XGC_Emb7 Xenopus (Silura... 44 1e-08 4
(CF218286) AGENCOURT_14997545 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(BX721106) Xenopus tropicalis EST, clone TTpA044j19 5'. 44 1e-08 4
(AK323721) Solanum lycopersicum cDNA, clone: LEFL1062DH03, H... 74 1e-08 2
(CR437445) Xenopus tropicalis EST, clone TTbA079h17 5'. 44 1e-08 4
(CX470231) JGI_XZG4263.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 1e-08 4
(CX341034) JGI_XZT45509.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CF223655) AGENCOURT_15069106 NICHD_XGC_Emb7 Xenopus (Silura... 44 1e-08 4
(CR585391) Xenopus tropicalis EST, clone THdA046m09 5'. 44 1e-08 4
(DN063625) JGI_CABD1389.fwd NIH_XGC_tropLun1 Xenopus (Silura... 44 1e-08 4
(CX485300) JGI_XZG34703.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CF223467) AGENCOURT_15090441 NICHD_XGC_Emb7 Xenopus (Silura... 44 1e-08 4
(CX419320) JGI_XZG13849.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX337487) JGI_XZT20435.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CX315268) JGI_XZT65524.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 1e-08 4
(CF220516) AGENCOURT_15040868 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(BT014168) Lycopersicon esculentum clone 133304R, mRNA seque... 74 1e-08 2
(CF216824) AGENCOURT_14979896 NICHD_XGC_Emb5 Xenopus (Silura... 44 1e-08 4
(BX743520) Xenopus tropicalis EST, clone TTpA030i20 5'. 44 1e-08 4
(CF378001) AGENCOURT_15349489 NICHD_XGC_Swb1N Xenopus (Silur... 44 1e-08 4
(CX466039) JGI_XZG47389.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 1e-08 4
(CX374928) JGI_XZT58829.fwd NIH_XGC_tropTad5 Xenopus (Silura... 44 2e-08 4
(BX756768) Xenopus tropicalis EST, clone TGas101e11 3'. 44 2e-08 4
(CX493665) JGI_XZG39506.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 2e-08 4
(BI443693) dai93e02.y1 NICHD_XGC_Ov1 Xenopus laevis cDNA clo... 44 2e-08 3
(DN983511) SV611B06_SOL18A_045 SV6 Solanum chacoense cDNA, m... 74 2e-08 1
(DB725675) Solanum lycopersicum cDNA, clone: LEFL2050B22, 5'... 74 2e-08 1
(DB721857) Solanum lycopersicum cDNA, clone: LEFL2039A12, 5'... 74 2e-08 1
(DB718056) Solanum lycopersicum cDNA, clone: LEFL2027N10, 5'... 74 2e-08 1
(DB698142) Solanum lycopersicum cDNA, clone: LEFL1062DH03, 5... 74 2e-08 1
(DB697995) Solanum lycopersicum cDNA, clone: LEFL1062CC05, 5... 74 2e-08 1
(CK720027) 20368 Swollen Stolon Solanum tuberosum cDNA, mRNA... 74 2e-08 1
(AI781196) EST262075 tomato susceptible, Cornell Solanum lyc... 74 2e-08 1
(AI772350) EST253450 tomato resistant, Cornell Solanum lycop... 74 2e-08 1
(BI932874) EST552763 tomato flower, 8 mm to preanthesis buds... 74 2e-08 1
(BI924399) EST544288 tomato flower, buds 0-3 mm Solanum lyco... 74 2e-08 1
(FS204807) Solanum lycopersicum cDNA, clone: LEFL3161J11, 5'... 74 2e-08 1
(FS204596) Solanum lycopersicum cDNA, clone: LEFL3160O19, 5'... 74 2e-08 1
(FS182309) Solanum lycopersicum cDNA, clone: LEFL3015O04, 5'... 74 2e-08 1
(CX473296) JGI_XZG6058.fwd NIH_XGC_tropGas7 Xenopus (Siluran... 44 2e-08 4
(CR579267) Xenopus tropicalis EST, clone THdA042d21 5'. 44 2e-08 4
(CR444749) Xenopus tropicalis EST, clone TTbA032h09 5'. 44 2e-08 4
(BX713811) Xenopus tropicalis EST, clone TTpA023f11 5'. 44 2e-08 4
(BF611499) dd82a10.y1 Wellcome CRC pcDNAI egg Xenopus laevis... 44 2e-08 3
(CX514653) JGI_XZG44754.fwd NIH_XGC_tropGas7 Xenopus (Silura... 44 2e-08 4
>(BJ428564) Dictyostelium discoideum cDNA clone:ddv12n10, 3' end,
single read.
Length = 766
Score = 1437 bits (725), Expect = 0.0
Identities = 725/725 (100%)
Strand = Plus / Minus
Query: 432 attaccagttgataaagtcgatatcatcatcagtgaatggatgggttatttcatgttata 491
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 766 attaccagttgataaagtcgatatcatcatcagtgaatggatgggttatttcatgttata 707
Query: 492 cgaagggtatgttagatactgtactctacgctcgtgataaatatttagtaccaggtggtg 551
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 706 cgaagggtatgttagatactgtactctacgctcgtgataaatatttagtaccaggtggtg 647
Query: 552 taattcttccagataaagcaagtttatatatcactgctattgaagatcaagattataaag 611
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 646 taattcttccagataaagcaagtttatatatcactgctattgaagatcaagattataaag 587
Query: 612 aagaaaaaattaattattggaataacgtttatggttttgatatgagttgtattagagaaa 671
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 586 aagaaaaaattaattattggaataacgtttatggttttgatatgagttgtattagagaaa 527
Query: 672 ttgcactcaaagaaccattagttgatgttgttcaaccaaatatgattgttacaaatgatt 731
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 526 ttgcactcaaagaaccattagttgatgttgttcaaccaaatatgattgttacaaatgatt 467
Query: 732 gttgtattttgactgttgatattatgacaattacaaaagatgaattaaaattcagatcag 791
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 466 gttgtattttgactgttgatattatgacaattacaaaagatgaattaaaattcagatcag 407
Query: 792 atttcaaattaaaagcattaagagacgatttaattcatgcatttgttgtatattttgata 851
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 406 atttcaaattaaaagcattaagagacgatttaattcatgcatttgttgtatattttgata 347
Query: 852 ttgagttttcaaaaggcgataaaccagtttgtttctcaactggaccaaaagcaaaatata 911
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346 ttgagttttcaaaaggcgataaaccagtttgtttctcaactggaccaaaagcaaaatata 287
Query: 912 ctcattggaaacaatcaatcatgtattttgaagatcatattaaaattcaacaaggtgaaa 971
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 286 ctcattggaaacaatcaatcatgtattttgaagatcatattaaaattcaacaaggtgaaa 227
Query: 972 tcattactggtactatggattgtgctccatttgataaaaatcaaagagatcttaaaatta 1031
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 tcattactggtactatggattgtgctccatttgataaaaatcaaagagatcttaaaatta 167
Query: 1032 aattagattttaactttgctggtgaattaatgaaaagttcttcttctttagaataccata 1091
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 aattagattttaactttgctggtgaattaatgaaaagttcttcttctttagaataccata 107
Query: 1092 tgagataaataattaattaatccaatccaatcaatcgatcaatcatatttagtggtctct 1151
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 tgagataaataattaattaatccaatccaatcaatcgatcaatcatatttagtggtctct 47
Query: 1152 gtttc 1156
|||||
Sbjct: 46 gtttc 42
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 108600042
Number of Hits to DB: 1,843,110,227
Number of extensions: 126337467
Number of successful extensions: 10983935
Number of sequences better than 10.0: 2653
Length of query: 1254
Length of database: 106,710,029,556
Length adjustment: 24
Effective length of query: 1230
Effective length of database: 104,103,628,548
Effective search space: 128047463114040
Effective search space used: 128047463114040
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home