Homology Contig-U10067-1 vs DNA
Query= Contig-U10067-1 (Contig-U10067-1Q) /CSM_Contig/Contig-U10067-1Q.Seq.d
(789 letters)
Database: ddbj_A
108,600,042 sequences; 106,710,029,556 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(BJ360941) Dictyostelium discoideum cDNA clone:ddc8l13, 5' e... 833 0.0 2
(AU272182) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 708 0.0 1
(AU272183) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 603 0.0 2
(AU272308) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 448 e-121 1
(AU272307) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 446 e-121 1
(AU271863) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 182 e-118 4
(AU272195) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-114 5
(AU275068) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-113 5
(AU275061) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-113 5
(AU271364) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 149 e-113 5
(AU272340) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-113 5
(AU272164) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-113 5
(AU272163) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-113 5
(AU272002) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 149 e-113 5
(AU272001) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 149 e-113 5
(AU271708) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 149 e-113 5
(AU271707) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 149 e-113 5
(AU272119) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-111 5
(AU275246) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-110 5
(AU275067) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-107 6
(AU275058) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 e-107 6
(AU272341) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 131 e-103 5
(AU272120) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 135 e-101 5
(AU275059) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 149 2e-96 3
(AU275060) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 117 1e-93 6
(AU272196) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 143 2e-83 4
(AU271862) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 109 4e-81 5
(AU271898) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 256 2e-80 3
(AU271368) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 252 2e-62 1
(AU271897) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 103 1e-61 4
(DN479581) altr015xp15 A. brassicicola mycelial culture infe... 52 7e-05 3
(EH098235) ia159g07.x1 mouse taste receptor cell, subtracted... 46 0.002 2
(DW374601) LRAGE019243 Liver regeneration after partial hepa... 56 0.002 1
(DT630555) EST1154967 Subtracted pine embryo library, Lib_C ... 56 0.002 1
(DN477775) altr004xb06 A. brassicicola mycelial culture infe... 56 0.002 1
(CK802186) NF40f08f44.r1 Tall Fescue PI283316 44 deg C Heat ... 56 0.002 1
(AJ746897) Sus scrofa EST from subtracted macrophage librari... 56 0.002 1
(CF935956) TrEST-B06C07.g TrEST-B Hypocrea jecorina cDNA clo... 56 0.002 1
(CF935860) TrEST-B09B07.g TrEST-B Hypocrea jecorina cDNA clo... 56 0.002 1
(EL814384) comvsuca1006_j07 SSH library of flowers of Capsic... 52 0.004 2
(CX124963) 1324637 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.004 2
(CX125810) 1326026 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.005 2
(CX124543) 1323887 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.005 2
(CX125046) 1325143 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.005 2
(CO497223) G.h.fbr-sw06613 G.h.fbr-sw Gossypium hirsutum cDN... 52 0.006 2
(EL813499) comvsuca1003_h18 SSH library of flowers of Capsic... 52 0.006 2
(AL714239) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL721152) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL714762) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL717534) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL725446) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL731222) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL726490) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL730366) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL719447) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL725445) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL728819) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL724482) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL722239) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(AL727858) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.008 2
(CQ420463) Sequence 5497 from Patent WO0151628. 54 0.009 1
(CQ410807) Sequence 17878 from Patent WO0170979. 54 0.009 1
(CQ409238) Sequence 16309 from Patent WO0170979. 54 0.009 1
(CQ408963) Sequence 16034 from Patent WO0170979. 54 0.009 1
(CQ408894) Sequence 15965 from Patent WO0170979. 54 0.009 1
(CQ408870) Sequence 15941 from Patent WO0170979. 54 0.009 1
(CQ408849) Sequence 15920 from Patent WO0170979. 54 0.009 1
(CQ408841) Sequence 15912 from Patent WO0170979. 54 0.009 1
(CQ408836) Sequence 15907 from Patent WO0170979. 54 0.009 1
(CQ408759) Sequence 15830 from Patent WO0170979. 54 0.009 1
(CQ408756) Sequence 15827 from Patent WO0170979. 54 0.009 1
(CQ408722) Sequence 15793 from Patent WO0170979. 54 0.009 1
(CQ402854) Sequence 9925 from Patent WO0170979. 54 0.009 1
(CQ396540) Sequence 3611 from Patent WO0170979. 54 0.009 1
(EH099444) ia176d05.x1 mouse taste receptor cell, subtracted... 54 0.009 1
(DY633363) Medicago--03-N18.b1 Subtracted medicago cDNA libr... 54 0.009 1
(DY633212) Medicago--03-C04.g1 Subtracted medicago cDNA libr... 54 0.009 1
(DY632979) Medicago--01-I12.b1 Subtracted medicago cDNA libr... 54 0.009 1
(DY632943) Medicago--01-C10.b1 Subtracted medicago cDNA libr... 54 0.009 1
(DY632818) Medicago--02-O11.g1 Subtracted medicago cDNA libr... 54 0.009 1
(DY632640) Medicago--01-C10.g1 Subtracted medicago cDNA libr... 54 0.009 1
(DY632563) Medicago--01-N24.g1 Subtracted medicago cDNA libr... 54 0.009 1
(DW374511) LRAGE019146 Liver regeneration after partial hepa... 54 0.009 1
(DV198546) 16412 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 54 0.009 1
(DV107311) SGP282805 Atlantic salmon intestine SSH cDNA libr... 54 0.009 1
(DV107255) SGP282749 Atlantic salmon intestine SSH cDNA libr... 54 0.009 1
(CX123881) 1323812 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 54 0.009 1
(CR628115) Quercus petraea bud EST, clone SSH11F01. 54 0.009 1
(AL715710) Danio rerio embryonic inner ear subtracted cDNA l... 54 0.009 1
(CN211227) Rt_fCd_05H01_M13-F Cadmium exposed rainbow trout ... 54 0.009 1
(CN211160) Rt_fCd_04H01_M13-F Cadmium exposed rainbow trout ... 54 0.009 1
(CN211079) Rt_fCd_03f05_M13-F Cadmium exposed rainbow trout ... 54 0.009 1
(AJ603210) Triticum aestivum EST, clone D10_T06_plate_61. 54 0.009 1
(CF061538) QCT22a04.yg QCT Zea mays cDNA clone QCT22a04, mRN... 54 0.009 1
(CF060867) QCT14g09.yg QCT Zea mays cDNA clone QCT14g09, mRN... 54 0.009 1
(CF054258) QCN27a04.yg QCN Zea mays cDNA clone QCN27a04, mRN... 54 0.009 1
(CD974686) QAE49b09.yg QAE Zea mays cDNA clone QAE49b09, mRN... 54 0.009 1
(CA739546) wpi2s.pk007.j16 wpi2s Triticum aestivum cDNA clon... 54 0.009 1
(CA736274) wpi1s.pk007.e7 wpi1s Triticum aestivum cDNA clone... 54 0.009 1
(CA735967) wpi1s.pk006.k3 wpi1s Triticum aestivum cDNA clone... 54 0.009 1
(CA735136) wpi1s.pk002.j4 wpi1s Triticum aestivum cDNA clone... 54 0.009 1
(CA726248) wet1s.pk002.h2 wet1s Triticum aestivum cDNA clone... 54 0.009 1
(FG551552) rmhcya0_000437 SSH library of cotton somatic embr... 54 0.009 1
(FG551363) rmhcyb0_000320 SSH library of differentially expr... 54 0.009 1
(FD473056) P2S_G04_SP6_024 frumisis1 Triticum turgidum subsp... 54 0.009 1
(ES789879) DEV-OYS-18F Crassostrea gigas early developmental... 54 0.009 1
(EG590273) Ga_S1TG_022C08_NP1 Ga_S1TG Gasterosteus aculeatus... 42 0.015 3
(AL724252) Danio rerio embryonic inner ear subtracted cDNA l... 42 0.028 2
(AL724222) Danio rerio embryonic inner ear subtracted cDNA l... 42 0.028 2
(AL724254) Danio rerio embryonic inner ear subtracted cDNA l... 42 0.028 2
(AL724221) Danio rerio embryonic inner ear subtracted cDNA l... 42 0.028 2
(CQ506188) Sequence 38055 from Patent WO0160860. 52 0.035 1
(CQ476244) Sequence 8111 from Patent WO0160860. 52 0.035 1
(CQ411028) Sequence 18099 from Patent WO0170979. 52 0.035 1
(CQ409507) Sequence 16578 from Patent WO0170979. 52 0.035 1
(CQ403123) Sequence 10194 from Patent WO0170979. 52 0.035 1
(CQ396815) Sequence 3886 from Patent WO0170979. 52 0.035 1
(AX185132) Sequence 827 from Patent WO0142467. 52 0.035 1
(EL813880) comvsuca1004_m22 SSH library of flowers of Capsic... 52 0.035 1
(EL813187) comvsuca1002_g16 SSH library of flowers of Capsic... 52 0.035 1
(EL813150) comvsuca1002_e14 SSH library of flowers of Capsic... 52 0.035 1
(EH108167) ia77c10.x1 mouse taste receptor cell, subtracted,... 52 0.035 1
(EH105854) ia29g07.x2 mouse taste receptor cell, subtracted,... 52 0.035 1
(EH105118) ia260h12.x1 mouse taste receptor cell, subtracted... 52 0.035 1
(EH097327) ia146g10.x1 mouse taste receptor cell, subtracted... 52 0.035 1
(EG356126) T-99-M13R Onu-t31 Ophiostoma novo-ulmi subsp. nov... 52 0.035 1
(DY633284) Medicago--03-E21.g1 Subtracted medicago cDNA libr... 52 0.035 1
(DY633167) Medicago--03-E21.b1 Subtracted medicago cDNA libr... 52 0.035 1
(DY632994) Medicago--01-E02.b1 Subtracted medicago cDNA libr... 52 0.035 1
(DW394256) LRAGE036369 Liver regeneration after partial hepa... 52 0.035 1
(DW394223) LRAGE036232 Liver regeneration after partial hepa... 52 0.035 1
(DW390812) LRAGE034903 Liver regeneration after partial hepa... 52 0.035 1
(DW387241) LRAGE030767 Liver regeneration after partial hepa... 52 0.035 1
(DW382978) LRAGE027873 Liver regeneration after partial hepa... 52 0.035 1
(DW379573) LRAGE024060 Liver regeneration after partial hepa... 52 0.035 1
(DW368135) LRAGE013781 Liver regeneration after partial hepa... 52 0.035 1
(DW367976) LRAGE013618 Liver regeneration after partial hepa... 52 0.035 1
(DW366782) LRAGE012371 Liver regeneration after partial hepa... 52 0.035 1
(DW336766) LRAGE049730 Liver regeneration after partial hepa... 52 0.035 1
(DW323463) LRAGE083291 Liver regeneration after partial hepa... 52 0.035 1
(DW321433) LRAGE081261 Liver regeneration after partial hepa... 52 0.035 1
(DW319913) LRAGE044741 Liver regeneration after partial hepa... 52 0.035 1
(DW313454) LRAGE074282 Liver regeneration after partial hepa... 52 0.035 1
(DW308423) LRAGE070251 Liver regeneration after partial hepa... 52 0.035 1
(DW304920) LRAGE066748 Liver regeneration after partial hepa... 52 0.035 1
(DW290002) LRAGE052830 Liver regeneration after partial hepa... 52 0.035 1
(DV202465) 17792 EMB Oncorhynchus mykiss cDNA clone 115RT_01... 52 0.035 1
(DV199584) 14011 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 52 0.035 1
(DV198278) 8223 leuk Oncorhynchus mykiss cDNA clone 06RT_12O... 52 0.035 1
(DV198196) 8140 leuk Oncorhynchus mykiss cDNA clone 06RT_12L... 52 0.035 1
(DV196444) 6276 leuk Oncorhynchus mykiss cDNA clone 06RT_06N... 52 0.035 1
(DV195447) 5203 leuk Oncorhynchus mykiss cDNA clone 06RT_04A... 52 0.035 1
(DV194906) 4602 leuk Oncorhynchus mykiss cDNA clone 06RT_02H... 52 0.035 1
(DV194710) 4390 leuk Oncorhynchus mykiss cDNA clone 06RT_01O... 52 0.035 1
(DV194361) 3999 leuk Oncorhynchus mykiss cDNA clone 06RT_12O... 52 0.035 1
(DV194281) 3916 leuk Oncorhynchus mykiss cDNA clone 06RT_12L... 52 0.035 1
(DV106967) SGP283181 Atlantic salmon gills SSH cDNA library ... 52 0.035 1
(DN826915) G.hir-20, 30 hrs post inoculation 225 Leaf cDNA 2... 52 0.035 1
(DN826158) G.hir-8,14 hrs post inoculation 101 Leaf cDNA 8,1... 52 0.035 1
(DN826099) G.hir-8,14 hrs post inoculation 42 Leaf cDNA 8,14... 52 0.035 1
(DN477804) altr004xf07 A. brassicicola mycelial culture infe... 52 0.035 1
(CX125781) 1326014 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.035 1
(CX125393) 1325270 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 52 0.035 1
(CX069042) EST282 subtracted libraries from oysters exposed ... 52 0.035 1
(CV972440) LRRGE02440 Liver regeneration after partial hepat... 52 0.035 1
(CV507159) C380 SSH Library from Glossina morsitans morsitan... 52 0.035 1
(CU664616) Plasmodium falciparum EST (SSH) from clone PU0AAA... 52 0.035 1
(CR628229) Quercus petraea bud EST, clone SSH12H11. 52 0.035 1
(CR627740) Quercus petraea bud EST, clone SSH06E01. 52 0.035 1
(CO499533) G.h.fbr-sw08923 G.h.fbr-sw Gossypium hirsutum cDN... 52 0.035 1
(CO495819) G.h.fbr-sw05209 G.h.fbr-sw Gossypium hirsutum cDN... 52 0.035 1
(CO494383) G.h.fbr-sw03773 G.h.fbr-sw Gossypium hirsutum cDN... 52 0.035 1
(CO490676) G.h.fbr-sw00066 G.h.fbr-sw Gossypium hirsutum cDN... 52 0.035 1
(AL727047) Danio rerio embryonic inner ear subtracted cDNA l... 52 0.035 1
(AL726278) Danio rerio embryonic inner ear subtracted cDNA l... 52 0.035 1
(AL726266) Danio rerio embryonic inner ear subtracted cDNA l... 52 0.035 1
(AL719295) Danio rerio embryonic inner ear subtracted cDNA l... 52 0.035 1
(AL717220) Danio rerio embryonic inner ear subtracted cDNA l... 52 0.035 1
(CN949742) XXXP150 Nicotiana tabacum Pollen PCR-based subtra... 52 0.035 1
(CK800838) NF04d12f39.r1 Tall Fescue PI283316 39 deg C Heat ... 52 0.035 1
(AJ864424) Medicago truncatula EST, clone MtPfEs224. 52 0.035 1
(AJ747684) Sus scrofa EST from subtracted macrophage librari... 52 0.035 1
(AJ602935) Triticum aestivum EST, clone A04_T06_plate_3. 52 0.035 1
(CF934733) TrEST-B21C11.g TrEST-B Hypocrea jecorina cDNA clo... 52 0.035 1
(CF063537) QCU22g11.yg QCU Zea mays cDNA clone QCU22g11, mRN... 52 0.035 1
(CF054764) QCN32f05.yg QCN Zea mays cDNA clone QCN32f05, mRN... 52 0.035 1
(CF053856) QCN21f06.yg QCN Zea mays cDNA clone QCN21f06, mRN... 52 0.035 1
(CF052229) QCM36h06.yg QCM Zea mays cDNA clone QCM36h06, mRN... 52 0.035 1
(CF051955) QCM33a08.yg QCM Zea mays cDNA clone QCM33a08, mRN... 52 0.035 1
(CF036660) QCG34h04.yg QCG Zea mays cDNA clone QCG34h04, mRN... 52 0.035 1
(CF036434) QCG31d12.yg QCG Zea mays cDNA clone QCG31d12, mRN... 52 0.035 1
(CD974387) QAE45f01.yg QAE Zea mays cDNA clone QAE45f01, mRN... 52 0.035 1
(CD859106) CNE.007K06F010727 CNE Pisum sativum cDNA clone CN... 52 0.035 1
(CD859095) CNE.007I15F010726 CNE Pisum sativum cDNA clone CN... 52 0.035 1
(CD859067) CNE.007E03F010726 CNE Pisum sativum cDNA clone CN... 52 0.035 1
(CB692900) AMGNNUC:SRCS1-00120-G12-A srcs1 (10883) Rattus no... 52 0.035 1
(CB691007) AMGNNUC:SRVC1-00135-C2-A srvc1 (10901) Rattus nor... 52 0.035 1
(CB367036) O2306 ookinete library Plasmodium berghei cDNA cl... 52 0.035 1
(CB165009) KS06002637 KS06 Capsicum annuum cDNA, mRNA sequence. 52 0.035 1
(CA746218) wri2s.pk005.m5 wri2s Triticum aestivum cDNA clone... 52 0.035 1
(CA743761) wri1s.pk005.d24 wri1s Triticum aestivum cDNA clon... 52 0.035 1
(CA736157) wpi1s.pk006.f15 wpi1s Triticum aestivum cDNA clon... 52 0.035 1
(CA735715) wpi1s.pk005.i21 wpi1s Triticum aestivum cDNA clon... 52 0.035 1
(BU671821) HaT422 Helianthus annuus Stem Helianthus annuus c... 52 0.035 1
(BU572411) BpHi w111 Differentially expressed cDNA libraries... 52 0.035 1
(BQ826346) OK-YZ-B180 Bermudagrass cv. Yukon SSH Library Cyn... 52 0.035 1
(AI079066) SWBmL3SBH11G01SK Brugia malayi L3 subtracted cDNA... 52 0.035 1
(BG322337) OK-YZ-B142 Bermudagrass/SDS SSH Library Cynodon d... 52 0.035 1
(AA933227) SWBmL3SA228T3 Brugia malayi L3 subtracted cDNA li... 52 0.035 1
(GR911523) Kal388 Kalanchoe x houghtonii SSH cDNA library Ka... 52 0.035 1
(GR421279) MALC02_H08 MALC Manihot esculenta cDNA clone MALC... 52 0.035 1
(GO897848) hsxa0_0008_F04.ab1 cucumber stamen suppression su... 52 0.035 1
(GO897830) hsxa0_0008_D08.ab1 cucumber stamen suppression su... 52 0.035 1
(GO255208) SS_S4_02_D06 SS_S4 Senecio squalidus cDNA, mRNA s... 52 0.035 1
(GE617572) Ss_14F_03H11_T3 Forward subtracted library from f... 52 0.035 1
(GE213361) 228 'BH' (somaclonal variated plants of Skaggs Bo... 52 0.035 1
(FK934632) ppo3h14e11t.1 Phytophthora parasitica appressoriu... 52 0.035 1
(FK701113) Hh_matS2_25A06_T3 Subtracted maternal mRNA librar... 52 0.035 1
(FG551832) rmhcyh0_000178 SSH library of cotton somatic embr... 52 0.035 1
(FG551822) rmhcyh0_000167 SSH library of cotton somatic embr... 52 0.035 1
(FG551647) rmhcya0_000551 SSH library of cotton somatic embr... 52 0.035 1
(FG551626) rmhcya0_000527 SSH library of cotton somatic embr... 52 0.035 1
(FG551580) rmhcya0_000468 SSH library of cotton somatic embr... 52 0.035 1
(FG551480) rmhcyb0_000473 SSH library of differentially expr... 52 0.035 1
(FG551461) rmhcyb0_000453 SSH library of differentially expr... 52 0.035 1
(FG551413) rmhcyb0_000386 SSH library of differentially expr... 52 0.035 1
(FG551398) rmhcyb0_000366 SSH library of differentially expr... 52 0.035 1
(FG548065) rmhcyc0_000239.y1.scf (Gossypium arboreum L.) Dro... 52 0.035 1
(FG394242) 29c09 goldfish brain cDNA library Carassius aurat... 52 0.035 1
(FG394238) 29c05 goldfish brain cDNA library Carassius aurat... 52 0.035 1
(FG394063) 26e02 goldfish brain cDNA library Carassius aurat... 52 0.035 1
(FG392948) 12a08 goldfish brain cDNA library Carassius aurat... 52 0.035 1
(FG235375) CHEG004009D11 EPI004 Trypanosoma rangeli cDNA, mR... 52 0.035 1
(FF579527) Fernando_27_G04 Drosophila gastrula substracted c... 52 0.035 1
(FE968673) B17 Subtraction library of Hyriopsis cumingii liv... 52 0.035 1
(FE968633) B35 Subtraction library of Hyriopsis cumingii liv... 52 0.035 1
(FE963889) 42B06 Salmo salar Embryos SSH reverse Pre blastul... 52 0.035 1
(FE041975) abalone1-050716_D03_d3_07.ab1 Haliotis discus han... 52 0.035 1
(FD779290) NADG-aaa01e07.g1 Rhodnius_prolixus_EST_NADG_Bacte... 52 0.035 1
(FD779018) NADG-aaa01e07.b1 Rhodnius_prolixus_EST_NADG_Bacte... 52 0.035 1
(FD480367) RS5 Glycine max cv. BX10 root short-term (RS) SSH... 52 0.035 1
(FD475013) 2P5_H06_T7_048 frumisis2 Triticum turgidum subsp.... 52 0.035 1
(FD473235) P10S_E12_SP6_087 frumisis1 Triticum turgidum subs... 52 0.035 1
(FD473058) P10S_D06_SP6_046 frumisis1 Triticum turgidum subs... 52 0.035 1
(EY221418) CP02-ES-001-001-E12-UE.F E-Sub(C-G) Moniliophthor... 52 0.035 1
(EX743052) znl_0014_G12 Gadus morhua pooled liver samples SS... 52 0.035 1
(EX452468) SSHGR24_Contig_24 Gigaspora rosea GR24 treated SS... 52 0.035 1
(ES789799) DEV-OYS-5S2_G6 Crassostrea gigas early developmen... 52 0.035 1
(ES659059) Peg100D Early stage of anther development specifi... 52 0.035 1
(ES456082) piTE012xK18.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES455743) piTE008xE13.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES455037) piTE010xA17.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES454791) piTE006xA14.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES453751) piTE001nD09.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES453137) piTE004xL07.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(ES452968) piTE002xE08.b1.ab1 PiTE - Interaction library bet... 52 0.035 1
(EU923597) Uncultured prokaryote clone GFUGF75TF genomic seq... 52 0.035 1
(CA734949) wpi1s.pk002.n22 wpi1s Triticum aestivum cDNA clon... 48 0.040 2
(CF063715) QCU2b08.yg QCU Zea mays cDNA clone QCU2b08, mRNA ... 44 0.040 2
(CO497836) G.h.fbr-sw07226 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.044 2
(CO499595) G.h.fbr-sw08985 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.049 2
(ES458320) piTB004nC08.b1.ab1 PiTB - Interaction library bet... 44 0.049 2
(ES457072) piTB004xE15.b2.ab1 PiTB - Interaction library bet... 44 0.049 2
(FG392914) 11f09 goldfish brain cDNA library Carassius aurat... 44 0.049 2
(CO494814) G.h.fbr-sw04204 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.049 2
(CO491714) G.h.fbr-sw01104 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.049 2
(FE900548) JF43 Polygonum sibiricum stem Knorringia sibirica... 48 0.061 2
(AL714134) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.062 2
(AM503942) Dreissena polymorpha EST, clone ZMHS_N_CN2. 46 0.066 2
(AL714168) Danio rerio embryonic inner ear subtracted cDNA l... 44 0.066 2
(GE621500) Ss_03F_17G08_T3 Forward subtracted library from f... 46 0.068 2
(EH097412) ia148b02.x1 mouse taste receptor cell, subtracted... 42 0.069 2
(CO497750) G.h.fbr-sw07140 G.h.fbr-sw Gossypium hirsutum cDN... 44 0.079 2
(CA736446) wpi1s.pk007.d19 wpi1s Triticum aestivum cDNA clon... 42 0.083 2
(AL716597) Danio rerio embryonic inner ear subtracted cDNA l... 48 0.088 2
(CF036816) QCG37c05.yg QCG Zea mays cDNA clone QCG37c05, mRN... 44 0.090 2
(DN479935) altr017xj06 A. brassicicola mycelial culture infe... 42 0.090 2
(CO494460) G.h.fbr-sw03850 G.h.fbr-sw Gossypium hirsutum cDN... 42 0.091 2
(CO498609) G.h.fbr-sw07999 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.092 2
(CO498619) G.h.fbr-sw08009 G.h.fbr-sw Gossypium hirsutum cDN... 48 0.093 2
(CO494294) G.h.fbr-sw03684 G.h.fbr-sw Gossypium hirsutum cDN... 42 0.096 2
(AL716798) Danio rerio embryonic inner ear subtracted cDNA l... 46 0.098 2
(DN479420) altr015xd07 A. brassicicola mycelial culture infe... 44 0.11 2
(GO944025) UFRST52 tobacco root and stem SSH cDNA Library Ni... 42 0.12 2
(FE896451) Y2-O13 Juvenile adult early flowering trifoliate ... 44 0.12 2
(FD425544) 20F09 Salmo salar Brain SSH forward Salmo salar c... 46 0.13 2
(GR422031) MAAC08_H09 MAAC Manihot esculenta cDNA clone MAAC... 46 0.13 2
(EH108065) ia75b08.x1 mouse taste receptor cell, subtracted,... 46 0.13 2
(GR421900) MAAC02_E01 MAAC Manihot esculenta cDNA clone MAAC... 46 0.13 2
(EA237524) Sequence 101839 from patent US 7214786. 50 0.14 1
(EA236926) Sequence 101241 from patent US 7214786. 50 0.14 1
(EA236886) Sequence 101201 from patent US 7214786. 50 0.14 1
(EA236805) Sequence 101120 from patent US 7214786. 50 0.14 1
(EA236773) Sequence 101088 from patent US 7214786. 50 0.14 1
(EA161925) Sequence 26240 from patent US 7214786. 50 0.14 1
(EA159000) Sequence 23315 from patent US 7214786. 50 0.14 1
(EA152860) Sequence 17175 from patent US 7214786. 50 0.14 1
(CS066397) Sequence 380 from Patent WO2005030998. 50 0.14 1
(CQ512745) Sequence 44612 from Patent WO0160860. 50 0.14 1
(CQ510468) Sequence 42335 from Patent WO0160860. 50 0.14 1
(CQ509884) Sequence 41751 from Patent WO0160860. 50 0.14 1
(CQ509715) Sequence 41582 from Patent WO0160860. 50 0.14 1
(CQ509604) Sequence 41471 from Patent WO0160860. 50 0.14 1
(CQ507339) Sequence 39206 from Patent WO0160860. 50 0.14 1
(CQ507313) Sequence 39180 from Patent WO0160860. 50 0.14 1
(CQ506177) Sequence 38044 from Patent WO0160860. 50 0.14 1
(CQ505504) Sequence 37371 from Patent WO0160860. 50 0.14 1
(CQ504896) Sequence 36763 from Patent WO0160860. 50 0.14 1
(CQ504886) Sequence 36753 from Patent WO0160860. 50 0.14 1
(CQ504849) Sequence 36716 from Patent WO0160860. 50 0.14 1
(CQ504764) Sequence 36631 from Patent WO0160860. 50 0.14 1
(CQ504742) Sequence 36609 from Patent WO0160860. 50 0.14 1
(CQ504703) Sequence 36570 from Patent WO0160860. 50 0.14 1
(CQ477133) Sequence 9000 from Patent WO0160860. 50 0.14 1
(CQ474923) Sequence 6790 from Patent WO0160860. 50 0.14 1
(CQ474913) Sequence 6780 from Patent WO0160860. 50 0.14 1
(CQ474876) Sequence 6743 from Patent WO0160860. 50 0.14 1
(CQ474789) Sequence 6656 from Patent WO0160860. 50 0.14 1
(CQ474766) Sequence 6633 from Patent WO0160860. 50 0.14 1
(CQ474727) Sequence 6594 from Patent WO0160860. 50 0.14 1
(CQ411957) Sequence 19028 from Patent WO0170979. 50 0.14 1
(CQ411946) Sequence 19017 from Patent WO0170979. 50 0.14 1
(CQ410839) Sequence 17910 from Patent WO0170979. 50 0.14 1
(CQ410629) Sequence 17700 from Patent WO0170979. 50 0.14 1
(CQ410235) Sequence 17306 from Patent WO0170979. 50 0.14 1
(CQ409257) Sequence 16328 from Patent WO0170979. 50 0.14 1
(CQ408551) Sequence 15622 from Patent WO0170979. 50 0.14 1
(CQ405573) Sequence 12644 from Patent WO0170979. 50 0.14 1
(CQ405562) Sequence 12633 from Patent WO0170979. 50 0.14 1
(CQ404423) Sequence 11494 from Patent WO0170979. 50 0.14 1
(CQ404245) Sequence 11316 from Patent WO0170979. 50 0.14 1
(CQ403851) Sequence 10922 from Patent WO0170979. 50 0.14 1
(CQ402167) Sequence 9238 from Patent WO0170979. 50 0.14 1
(CQ399295) Sequence 6366 from Patent WO0170979. 50 0.14 1
(CQ399284) Sequence 6355 from Patent WO0170979. 50 0.14 1
(CQ398136) Sequence 5207 from Patent WO0170979. 50 0.14 1
(CQ397953) Sequence 5024 from Patent WO0170979. 50 0.14 1
(CQ397552) Sequence 4623 from Patent WO0170979. 50 0.14 1
(CQ395838) Sequence 2909 from Patent WO0170979. 50 0.14 1
(AX185191) Sequence 886 from Patent WO0142467. 50 0.14 1
(GC479712) Sequence 380 from patent US 7387875. 50 0.14 1
(ES323075) mfcorjr1c11 SSH Library of cold-responsive cDNA M... 50 0.14 1
(EL813710) comvsuca1004_d21 SSH library of flowers of Capsic... 50 0.14 1
(EL812873) comvsuca1001_f10 SSH library of flowers of Capsic... 50 0.14 1
(EL812871) comvsuca1001_f07 SSH library of flowers of Capsic... 50 0.14 1
(EH107019) ia52a03.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH106958) ia51a09.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH106020) ia35b04.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH106004) ia33h12.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH105869) ia30e10.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH105784) ia28e08.x2 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH104359) ia249f02.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH103557) ia238g03.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH103110) ia230e11.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH101271) ia203e08.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH101269) ia203e04.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH101031) ia19b04.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH100911) ia197c10.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH100167) ia187d07.x2 mouse taste receptor cell, subtracted... 50 0.14 1
(EH098597) ia164a12.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH097533) ia149h06.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH095592) ia11e01.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EH094615) ia102d06.x1 mouse taste receptor cell, subtracted... 50 0.14 1
(EH094395) ia08g05.x1 mouse taste receptor cell, subtracted,... 50 0.14 1
(EG590412) Ga_S1TG_024B07_NP1 Ga_S1TG Gasterosteus aculeatus... 50 0.14 1
(EC365759) OSI00305 Oryza sativa indica, Clontech PCR select... 50 0.14 1
(EB643231) EST-D26 Homo sapiens tracheal epithelium cell lin... 50 0.14 1
(DY633340) Medicago--03-H10.b1 Subtracted medicago cDNA libr... 50 0.14 1
(DY632478) Medicago--01-I18.g1 Subtracted medicago cDNA libr... 50 0.14 1
(DY529755) Sb022 Salicornia bigelovii Torr. cDNA library bas... 50 0.14 1
(DY467720) Ss_Rev_11D03_T3 Reverse subtracted library from f... 50 0.14 1
(DY231562) 1E8 goldfish brain cDNA library Carassius auratus... 50 0.14 1
(DW403825) LRAGE008665 Liver regeneration after partial hepa... 50 0.14 1
(DW397688) LRAGE040082 Liver regeneration after partial hepa... 50 0.14 1
(DW397010) LRAGE039404 Liver regeneration after partial hepa... 50 0.14 1
(DW396713) LRAGE039107 Liver regeneration after partial hepa... 50 0.14 1
(DW394265) LRAGE036454 Liver regeneration after partial hepa... 50 0.14 1
(DW394249) LRAGE036346 Liver regeneration after partial hepa... 50 0.14 1
(DW393856) LRAGE033448 Liver regeneration after partial hepa... 50 0.14 1
(DW393674) LRAGE032067 Liver regeneration after partial hepa... 50 0.14 1
(DW391314) LRAGE035479 Liver regeneration after partial hepa... 50 0.14 1
(DW390472) LRAGE034515 Liver regeneration after partial hepa... 50 0.14 1
(DW390048) LRAGE034012 Liver regeneration after partial hepa... 50 0.14 1
(DW389474) LRAGE033351 Liver regeneration after partial hepa... 50 0.14 1
(DW388277) LRAGE031982 Liver regeneration after partial hepa... 50 0.14 1
(DW387964) LRAGE031626 Liver regeneration after partial hepa... 50 0.14 1
(DW387071) LRAGE030579 Liver regeneration after partial hepa... 50 0.14 1
(DW386496) LRAGE029376 Liver regeneration after partial hepa... 50 0.14 1
(DW385626) LRAGE029822 Liver regeneration after partial hepa... 50 0.14 1
(DW382417) LRAGE027244 Liver regeneration after partial hepa... 50 0.14 1
(DW381816) LRAGE026583 Liver regeneration after partial hepa... 50 0.14 1
(DW381037) LRAGE025720 Liver regeneration after partial hepa... 50 0.14 1
(DW380887) LRAGE025543 Liver regeneration after partial hepa... 50 0.14 1
(DW380522) LRAGE025133 Liver regeneration after partial hepa... 50 0.14 1
(DW379768) LRAGE024269 Liver regeneration after partial hepa... 50 0.14 1
(DW379679) LRAGE024173 Liver regeneration after partial hepa... 50 0.14 1
(DW379392) LRAGE023863 Liver regeneration after partial hepa... 50 0.14 1
(DW379007) LRAGE023446 Liver regeneration after partial hepa... 50 0.14 1
(DW376898) LRAGE021777 Liver regeneration after partial hepa... 50 0.14 1
(DW376564) LRAGE021405 Liver regeneration after partial hepa... 50 0.14 1
(DW375897) LRAGE020672 Liver regeneration after partial hepa... 50 0.14 1
(DW374780) LRAGE019443 Liver regeneration after partial hepa... 50 0.14 1
(DW373301) LRAGE018895 Liver regeneration after partial hepa... 50 0.14 1
(DW372644) LRAGE018149 Liver regeneration after partial hepa... 50 0.14 1
(DW369525) LRAGE015252 Liver regeneration after partial hepa... 50 0.14 1
(DW369450) LRAGE015171 Liver regeneration after partial hepa... 50 0.14 1
(DW369150) LRAGE014851 Liver regeneration after partial hepa... 50 0.14 1
(DW366601) LRAGE012179 Liver regeneration after partial hepa... 50 0.14 1
(DW366130) LRAGE011689 Liver regeneration after partial hepa... 50 0.14 1
(DW365131) LRAGE010646 Liver regeneration after partial hepa... 50 0.14 1
(DW363783) LRAGE009202 Liver regeneration after partial hepa... 50 0.14 1
(DW363619) LRAGE009025 Liver regeneration after partial hepa... 50 0.14 1
(DW336077) LRAGE049041 Liver regeneration after partial hepa... 50 0.14 1
(DW335420) LRAGE048384 Liver regeneration after partial hepa... 50 0.14 1
(DW335139) LRAGE048103 Liver regeneration after partial hepa... 50 0.14 1
(DW334180) LRAGE047144 Liver regeneration after partial hepa... 50 0.14 1
(DW333712) LRAGE046676 Liver regeneration after partial hepa... 50 0.14 1
(DW333267) LRAGE092095 Liver regeneration after partial hepa... 50 0.14 1
(DW332968) LRAGE091796 Liver regeneration after partial hepa... 50 0.14 1
(DW330097) LRAGE089925 Liver regeneration after partial hepa... 50 0.14 1
(DW329957) LRAGE089785 Liver regeneration after partial hepa... 50 0.14 1
(DW328985) LRAGE088813 Liver regeneration after partial hepa... 50 0.14 1
(DW328588) LRAGE088416 Liver regeneration after partial hepa... 50 0.14 1
(DW326733) LRAGE086561 Liver regeneration after partial hepa... 50 0.14 1
(DW325381) LRAGE085209 Liver regeneration after partial hepa... 50 0.14 1
(DW322881) LRAGE082709 Liver regeneration after partial hepa... 50 0.14 1
(DW321391) LRAGE081219 Liver regeneration after partial hepa... 50 0.14 1
(DW319948) LRAGE044776 Liver regeneration after partial hepa... 50 0.14 1
(DW319303) LRAGE080131 Liver regeneration after partial hepa... 50 0.14 1
(DW318202) LRAGE079030 Liver regeneration after partial hepa... 50 0.14 1
(DW318075) LRAGE078903 Liver regeneration after partial hepa... 50 0.14 1
(DW317636) LRAGE078464 Liver regeneration after partial hepa... 50 0.14 1
(DW316712) LRAGE077540 Liver regeneration after partial hepa... 50 0.14 1
(DW316374) LRAGE077202 Liver regeneration after partial hepa... 50 0.14 1
(DW316259) LRAGE077087 Liver regeneration after partial hepa... 50 0.14 1
(DW314751) LRAGE075579 Liver regeneration after partial hepa... 50 0.14 1
(DW308635) LRAGE070463 Liver regeneration after partial hepa... 50 0.14 1
(DW308447) LRAGE070275 Liver regeneration after partial hepa... 50 0.14 1
(DW305507) LRAGE067335 Liver regeneration after partial hepa... 50 0.14 1
(DW305499) LRAGE067327 Liver regeneration after partial hepa... 50 0.14 1
(DW302404) LRAGE064232 Liver regeneration after partial hepa... 50 0.14 1
(DW301444) LRAGE063272 Liver regeneration after partial hepa... 50 0.14 1
(DW300515) LRAGE062343 Liver regeneration after partial hepa... 50 0.14 1
(DW298393) LRAGE043221 Liver regeneration after partial hepa... 50 0.14 1
(DW297268) LRAGE060096 Liver regeneration after partial hepa... 50 0.14 1
(DW294566) LRAGE057394 Liver regeneration after partial hepa... 50 0.14 1
(DW294304) LRAGE057132 Liver regeneration after partial hepa... 50 0.14 1
(DW291479) LRAGE054307 Liver regeneration after partial hepa... 50 0.14 1
(DW288948) LRAGE051776 Liver regeneration after partial hepa... 50 0.14 1
(DW287624) LRAGE042452 Liver regeneration after partial hepa... 50 0.14 1
(DW287623) LRAGE042451 Liver regeneration after partial hepa... 50 0.14 1
(DV217281) 1609 leuk Oncorhynchus mykiss cDNA clone 06RT_05L... 50 0.14 1
(DV201151) 15821 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 50 0.14 1
(DV200957) 15607 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 50 0.14 1
(DV200923) 15566 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 50 0.14 1
(DV199791) 14254 EMB Oncorhynchus mykiss cDNA clone 115RT_00... 50 0.14 1
(DV198191) 8135 leuk Oncorhynchus mykiss cDNA clone 06RT_12K... 50 0.14 1
(DV197857) 7776 leuk Oncorhynchus mykiss cDNA clone 06RT_11L... 50 0.14 1
(DV197371) 7272 leuk Oncorhynchus mykiss cDNA clone 06RT_10G... 50 0.14 1
(DV197239) 7136 leuk Oncorhynchus mykiss cDNA clone 06RT_10B... 50 0.14 1
(DV197011) 6895 leuk Oncorhynchus mykiss cDNA clone 06RT_08H... 50 0.14 1
(DV196023) 5833 leuk Oncorhynchus mykiss cDNA clone 06RT_05L... 50 0.14 1
(DV195315) 5052 leuk Oncorhynchus mykiss cDNA clone 06RT_03K... 50 0.14 1
(DV195075) 4788 leuk Oncorhynchus mykiss cDNA clone 06RT_02P... 50 0.14 1
(DV194816) 4506 leuk Oncorhynchus mykiss cDNA clone 06RT_02D... 50 0.14 1
(DV194481) 4134 leuk Oncorhynchus mykiss cDNA clone 06RT_01E... 50 0.14 1
(DV194040) 3649 leuk Oncorhynchus mykiss cDNA clone 06RT_12A... 50 0.14 1
(DV193365) 2912 leuk Oncorhynchus mykiss cDNA clone 06RT_10B... 50 0.14 1
(DV193145) 2671 leuk Oncorhynchus mykiss cDNA clone 06RT_08H... 50 0.14 1
(DV192317) 1742 leuk Oncorhynchus mykiss cDNA clone 06RT_06A... 50 0.14 1
(DV191518) 828 leuk Oncorhynchus mykiss cDNA clone 06RT_03K1... 50 0.14 1
(DV190856) 102 leuk Oncorhynchus mykiss cDNA clone 06RT_01E0... 50 0.14 1
(DV107145) SGP283360 Atlantic salmon gills SSH cDNA library ... 50 0.14 1
(DV107010) SGP283224 Atlantic salmon gills SSH cDNA library ... 50 0.14 1
(DV106881) SGP282621 Atlantic salmon gills SSH cDNA library ... 50 0.14 1
(DT639712) 00068 leafy spurge subtractive cDNA libraries Eup... 50 0.14 1
(DT639275) 00101 leafy spurge subtractive cDNA libraries Eup... 50 0.14 1
(DT639265) 00041 leafy spurge subtractive cDNA libraries Eup... 50 0.14 1
(AU311356) Bombyx mori mRNA, clone: TT8-80. 50 0.14 1
(AU311241) Bombyx mori mRNA, clone: TT4-11. 50 0.14 1
(DR752127) 72R320 Wheat FHB SSH Library Triticum aestivum cD... 50 0.14 1
(DN837356) ESTT11H10 oropharyngeal tonsils and mandibular ly... 50 0.14 1
(DN479654) altr016xe09 A. brassicicola mycelial culture infe... 50 0.14 1
(DN154575) 1348_mouse oocyte cDNA subtracted library Mouse o... 50 0.14 1
(DC879106) Lentinula edodes mRNA, clone: ibrcr01f07, unspeci... 50 0.14 1
(DC878972) Lentinula edodes mRNA, clone: ibrcf06b01, unspeci... 50 0.14 1
(CX944792) DH0AGB3ZG02RM1 HaDisCtPSC8vsPh Helianthus annuus ... 50 0.14 1
(CX944770) DH0AGB3ZD02RM1 HaDisCtPSC8vsPh Helianthus annuus ... 50 0.14 1
(CX944751) DH0AGB3ZA03RM1 HaDisCtPSC8vsPh Helianthus annuus ... 50 0.14 1
(CX944373) DH0AGB20ZC02RM1 HaDisCtPSC8vsPh Helianthus annuus... 50 0.14 1
(CX944301) DH0AGB19ZC12RM1 HaDisCtPSC8vsPh Helianthus annuus... 50 0.14 1
(CX126519) gamEST 604 Gamay NJB cDNA Library Vitis vinifera ... 50 0.14 1
(CX125954) gamEST 39 Gamay NJB cDNA Library Vitis vinifera c... 50 0.14 1
(CX124928) 1324954 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX123931) 1323699 NCCCWA 05RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX068005) 1323208 NCCCWA 04RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX067835) 1322974 NCCCWA 04RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX067726) 1322206 NCCCWA 04RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX067146) 1321692 NCCCWA 04RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
(CX067093) 1321672 NCCCWA 04RT Oncorhynchus mykiss cDNA clon... 50 0.14 1
>(BJ360941) Dictyostelium discoideum cDNA clone:ddc8l13, 5' end,
single read.
Length = 562
Score = 833 bits (420), Expect(2) = 0.0
Identities = 420/420 (100%)
Strand = Plus / Minus
Query: 223 aatggtatcattggaaaagtggacgcattctccaagtattgggtcacaatagtcgttggt 282
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 493 aatggtatcattggaaaagtggacgcattctccaagtattgggtcacaatagtcgttggt 434
Query: 283 acattcattatcatcatggcaatcaatttcatcgtattcacaaataccagtttctctatt 342
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 433 acattcattatcatcatggcaatcaatttcatcgtattcacaaataccagtttctctatt 374
Query: 343 acaacctaatggaatttgacatgggtttggtgctggacaatttacttttggtatagcaac 402
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 373 acaacctaatggaatttgacatgggtttggtgctggacaatttacttttggtatagcaac 314
Query: 403 acaaccactttgagtatcacatagaaacatatcacataaattttctggtgggcataatga 462
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 313 acaaccactttgagtatcacatagaaacatatcacataaattttctggtgggcataatga 254
Query: 463 attatttggagtatttttaacaccatatctatcactacatgtgtctactgtacaatcaac 522
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 253 attatttggagtatttttaacaccatatctatcactacatgtgtctactgtacaatcaac 194
Query: 523 ttcatcatctaaatctattgtttcatataaacatgttgaatttctgcaacctataaatga 582
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 ttcatcatctaaatctattgtttcatataaacatgttgaatttctgcaacctataaatga 134
Query: 583 ataacaatttctattttcaacgcaataagtttctccacaatactctgaacaacaaagttt 642
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133 ataacaatttctattttcaacgcaataagtttctccacaatactctgaacaacaaagttt 74
Score = 137 bits (69), Expect(2) = 0.0
Identities = 69/69 (100%)
Strand = Plus / Minus
Query: 153 tttacagccaaactctccacatactccacttaggacacaagtagagaagttacttgcttt 212
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 tttacagccaaactctccacatactccacttaggacacaagtagagaagttacttgcttt 503
Query: 213 atttgaaca 221
|||||||||
Sbjct: 502 atttgaaca 494
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 108600042
Number of Hits to DB: 744,563,920
Number of extensions: 41210871
Number of successful extensions: 3411196
Number of sequences better than 10.0: 57034
Length of query: 789
Length of database: 106,710,029,556
Length adjustment: 24
Effective length of query: 765
Effective length of database: 104,103,628,548
Effective search space: 79639275839220
Effective search space used: 79639275839220
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home