Homology Contig-U04536-1 vs DNA
Query= Contig-U04536-1 (Contig-U04536-1Q) /CSM_Contig/Contig-U04536-1Q.Seq.d
(507 letters)
Database: ddbj_A
102,105,510 sequences; 101,790,757,118 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(C84223) Dictyostelium discoideum slug cDNA, clone SSB338. 438 e-119 1
(AU071371) Dictyostelium discoideum slug cDNA, clone SSB338. 153 4e-36 2
(AC115258) Rattus norvegicus clone CH230-367A2, *** SEQUENCI... 48 0.33 1
(AC110954) Rattus norvegicus clone CH230-62F5, *** SEQUENCIN... 48 0.33 1
(BH152023) ENTQE60TR Entamoeba histolytica Sheared DNA Entam... 38 2.2 2
(AZ685213) ENTIN72TR Entamoeba histolytica Sheared DNA Entam... 38 2.3 2
(AC217787) Solanum lycopersicum chromosome 9 clone C09HBa011... 38 3.1 2
(AL935031) Zebrafish DNA sequence from clone CH211-93I23. 44 5.1 1
(AC079442) Mus musculus strain C57BL/6J chromosome 3 clone r... 44 5.1 1
(FB712550) Sequence 224 from Patent WO2008008082. 44 5.1 1
(FB712549) Sequence 223 from Patent WO2008008082. 44 5.1 1
(FB712548) Sequence 222 from Patent WO2008008082. 44 5.1 1
(FB712547) Sequence 221 from Patent WO2008008082. 44 5.1 1
(FB712546) Sequence 220 from Patent WO2008008082. 44 5.1 1
(FB712545) Sequence 219 from Patent WO2008008082. 44 5.1 1
(FB712544) Sequence 218 from Patent WO2008008082. 44 5.1 1
(FB712543) Sequence 217 from Patent WO2008008082. 44 5.1 1
(FB712542) Sequence 216 from Patent WO2008008082. 44 5.1 1
(FB712541) Sequence 215 from Patent WO2008008082. 44 5.1 1
(FB712540) Sequence 214 from Patent WO2008008082. 44 5.1 1
(EA294387) Sequence 10 from patent US 7276473. 44 5.1 1
(EA273106) Sequence 1 from patent US 7255865. 44 5.1 1
(EA094639) Sequence 7 from patent US 7192596. 44 5.1 1
(DM006955) GENETICALLY ENGINEERED CLOSTRIDIAL GENES, PROTEIN... 44 5.1 1
(DL213881) Recombinant Toxin Fragments. 44 5.1 1
(DL193863) Optimizing Expression of Active Botulinum Toxin T... 44 5.1 1
(DL193862) Optimizing Expression of Active Botulinum Toxin T... 44 5.1 1
(DL193752) Optimizing Expression of Active Botulinum Toxin T... 44 5.1 1
(DJ361200) COMPOSITIONS FOR USE IN IDENTIFICATION OF BACTERIA. 44 5.1 1
(DI120364) Cell transducing botoxin fusion protein. 44 5.1 1
(CS812577) Sequence 15 from Patent WO2007104567. 44 5.1 1
(CS715716) Sequence 15 from Patent EP1834962. 44 5.1 1
(CS673956) Sequence 5 from Patent WO2006076902. 44 5.1 1
(CS673954) Sequence 3 from Patent WO2006076902. 44 5.1 1
(CS673952) Sequence 1 from Patent WO2006076902. 44 5.1 1
(CS401848) Sequence 4 from Patent WO2006017715. 44 5.1 1
(CS401846) Sequence 2 from Patent WO2006017715. 44 5.1 1
(CS401834) Sequence 115 from Patent WO2006017749. 44 5.1 1
(CS401833) Sequence 114 from Patent WO2006017749. 44 5.1 1
(CS401721) Sequence 2 from Patent WO2006017749. 44 5.1 1
(CS390503) Sequence 132 from Patent WO2006026780. 44 5.1 1
(CS390502) Sequence 131 from Patent WO2006026780. 44 5.1 1
(CS390501) Sequence 130 from Patent WO2006026780. 44 5.1 1
(CS390500) Sequence 129 from Patent WO2006026780. 44 5.1 1
(CS390499) Sequence 128 from Patent WO2006026780. 44 5.1 1
(CS390498) Sequence 127 from Patent WO2006026780. 44 5.1 1
(CS390497) Sequence 126 from Patent WO2006026780. 44 5.1 1
(CS390496) Sequence 125 from Patent WO2006026780. 44 5.1 1
(CS390495) Sequence 124 from Patent WO2006026780. 44 5.1 1
(CS390494) Sequence 123 from Patent WO2006026780. 44 5.1 1
(CS390493) Sequence 122 from Patent WO2006026780. 44 5.1 1
(CS390492) Sequence 121 from Patent WO2006026780. 44 5.1 1
(CS390491) Sequence 120 from Patent WO2006026780. 44 5.1 1
(CS390490) Sequence 119 from Patent WO2006026780. 44 5.1 1
(CS390489) Sequence 118 from Patent WO2006026780. 44 5.1 1
(CS390488) Sequence 117 from Patent WO2006026780. 44 5.1 1
(CS390487) Sequence 116 from Patent WO2006026780. 44 5.1 1
(CS390486) Sequence 115 from Patent WO2006026780. 44 5.1 1
(CS390485) Sequence 114 from Patent WO2006026780. 44 5.1 1
(CS390484) Sequence 113 from Patent WO2006026780. 44 5.1 1
(CS390483) Sequence 112 from Patent WO2006026780. 44 5.1 1
(CS390482) Sequence 111 from Patent WO2006026780. 44 5.1 1
(CS390481) Sequence 110 from Patent WO2006026780. 44 5.1 1
(CS390480) Sequence 109 from Patent WO2006026780. 44 5.1 1
(CQ794639) Sequence 7 from Patent WO2004024909. 44 5.1 1
(BD301579) Soluble recombinant Botulinal toxin protein. 44 5.1 1
(BD009880) Recombinant toxin fragments. 44 5.1 1
(A69689) Sequence 7 from Patent WO9807864. 44 5.1 1
(GP055241) Sequence 1 from patent US 7479281. 44 5.1 1
(GM835934) Sequence 132 from Patent EP1982996. 44 5.1 1
(GM835933) Sequence 131 from Patent EP1982996. 44 5.1 1
(GM835932) Sequence 130 from Patent EP1982996. 44 5.1 1
(GM835931) Sequence 129 from Patent EP1982996. 44 5.1 1
(GM835930) Sequence 128 from Patent EP1982996. 44 5.1 1
(GM835929) Sequence 127 from Patent EP1982996. 44 5.1 1
(GM835928) Sequence 126 from Patent EP1982996. 44 5.1 1
(GM835927) Sequence 125 from Patent EP1982996. 44 5.1 1
(GM835926) Sequence 124 from Patent EP1982996. 44 5.1 1
(GM835925) Sequence 123 from Patent EP1982996. 44 5.1 1
(GM835924) Sequence 122 from Patent EP1982996. 44 5.1 1
(GM835923) Sequence 121 from Patent EP1982996. 44 5.1 1
(GM835922) Sequence 120 from Patent EP1982996. 44 5.1 1
(GM835921) Sequence 119 from Patent EP1982996. 44 5.1 1
(GM835920) Sequence 118 from Patent EP1982996. 44 5.1 1
(GM835919) Sequence 117 from Patent EP1982996. 44 5.1 1
(GM835918) Sequence 116 from Patent EP1982996. 44 5.1 1
(GM835917) Sequence 115 from Patent EP1982996. 44 5.1 1
(GM835916) Sequence 114 from Patent EP1982996. 44 5.1 1
(GM835915) Sequence 113 from Patent EP1982996. 44 5.1 1
(GM835914) Sequence 112 from Patent EP1982996. 44 5.1 1
(GM835913) Sequence 111 from Patent EP1982996. 44 5.1 1
(GM835912) Sequence 110 from Patent EP1982996. 44 5.1 1
(GM835911) Sequence 109 from Patent EP1982996. 44 5.1 1
(GM835770) Sequence 132 from Patent EP1982997. 44 5.1 1
(GM835769) Sequence 131 from Patent EP1982997. 44 5.1 1
(GM835768) Sequence 130 from Patent EP1982997. 44 5.1 1
(GM835767) Sequence 129 from Patent EP1982997. 44 5.1 1
(GM835766) Sequence 128 from Patent EP1982997. 44 5.1 1
(GM835765) Sequence 127 from Patent EP1982997. 44 5.1 1
(GM835764) Sequence 126 from Patent EP1982997. 44 5.1 1
(GM835763) Sequence 125 from Patent EP1982997. 44 5.1 1
(GM835762) Sequence 124 from Patent EP1982997. 44 5.1 1
(GM835761) Sequence 123 from Patent EP1982997. 44 5.1 1
(GM835760) Sequence 122 from Patent EP1982997. 44 5.1 1
(GM835759) Sequence 121 from Patent EP1982997. 44 5.1 1
(GM835758) Sequence 120 from Patent EP1982997. 44 5.1 1
(GM835757) Sequence 119 from Patent EP1982997. 44 5.1 1
(GM835756) Sequence 118 from Patent EP1982997. 44 5.1 1
(GM835755) Sequence 117 from Patent EP1982997. 44 5.1 1
(GM835754) Sequence 116 from Patent EP1982997. 44 5.1 1
(GM835753) Sequence 115 from Patent EP1982997. 44 5.1 1
(GM835752) Sequence 114 from Patent EP1982997. 44 5.1 1
(GM835751) Sequence 113 from Patent EP1982997. 44 5.1 1
(GM835750) Sequence 112 from Patent EP1982997. 44 5.1 1
(GM835749) Sequence 111 from Patent EP1982997. 44 5.1 1
(GM835748) Sequence 110 from Patent EP1982997. 44 5.1 1
(GM835747) Sequence 109 from Patent EP1982997. 44 5.1 1
(AX036248) Sequence 27 from Patent EP1041149. 44 5.1 1
(AR772153) Sequence 27 from patent US 6967088. 44 5.1 1
(AR630984) Sequence 10 from patent US 6843998. 44 5.1 1
(AR576454) Sequence 10 from patent US 6776990. 44 5.1 1
(AR390896) Sequence 27 from patent US 6613329. 44 5.1 1
(AR235490) Sequence 7 from patent US 6461617. 44 5.1 1
(AR169142) Sequence 27 from patent US 6290960. 44 5.1 1
(AR000031) Sequence 27 from patent US 5736139. 44 5.1 1
(CZ539508) SRAA-aad26b10.g1 Strongyloides ratti whole genome... 44 5.1 1
(AG564771) Mus musculus molossinus DNA, clone:MSMg01-485E16.... 44 5.1 1
(AG386603) Mus musculus molossinus DNA, clone:MSMg01-199M20.... 44 5.1 1
(BG276153) mac32g12.y1 Soares mouse 3NbMS Mus musculus cDNA ... 44 5.1 1
(FF374088) TN-LN-TP-310807-libF_D05 Trichoplusia ni whole la... 44 5.1 1
(X87848) C.botulinum NTNH gene, BoNT/A gene & upstream ORF, ... 44 5.1 1
(X73423) C.botulinum gene for infant neurotoxin type A. 44 5.1 1
(X52066) Clostridium botulinum botA gene for type A neurotoxin. 44 5.1 1
(M30196) C.botulinum neurotoxin gene, complete cds. 44 5.1 1
(EU429475) Clostridium botulinum botulinum neurotoxin type A... 44 5.1 1
(EU416227) Clostridium botulinum strain CDC1903 Bont/A gene,... 44 5.1 1
(EU416226) Clostridium botulinum strain CDC1882 Bont/A gene,... 44 5.1 1
(EU416225) Clostridium botulinum strain CDC51303 Bont/A gene... 44 5.1 1
(EU341306) Clostridium botulinum strain CDC/A3 boNT/A3 gene ... 44 5.1 1
(EU341305) Clostridium botulinum strain A1/A2 boNT/A gene cl... 44 5.1 1
(EF506573) Clostridium botulinum botulinum neurotoxin type A... 44 5.1 1
(EF506572) Clostridium botulinum botulinum neurotoxin type A... 44 5.1 1
(EF470982) Clostridium botulinum isolation-source soil botul... 44 5.1 1
(EF470981) Clostridium botulinum isolation-source stool botu... 44 5.1 1
(EF033126) Clostridium botulinum strain Hall 183 neurotoxin ... 44 5.1 1
(EF028393) Clostridium botulinum strain CDC 1436 neurotoxin ... 44 5.1 1
(EF028392) Clostridium botulinum strain CDC 297 neurotoxin A... 44 5.1 1
(EF028391) Clostridium botulinum strain ATCC 25763 neurotoxi... 44 5.1 1
(DQ409059) Clostridium botulinum HA70 (ha70), HA17 (ha17), H... 44 5.1 1
(DQ310546) Clostridium botulinum strain Mascarpone boNT/A ge... 44 5.1 1
(DQ185900) Clostridium botulinum strain Loch Maree neurotoxi... 44 5.1 1
(CP001348) Clostridium cellulolyticum H10, complete genome. 44 5.1 1
(CP000963) Clostridium botulinum A3 str. Loch Maree plasmid ... 44 5.1 1
(CP000727) Clostridium botulinum A str. Hall, complete genome. 44 5.1 1
(CP000726) Clostridium botulinum A str. ATCC 19397, complete... 44 5.1 1
(AY953275) Clostridium botulinum strain FRI-H1A2 type A2 bot... 44 5.1 1
(AY166872) Clostridium botulinum isolate Kumgo neurotoxin ty... 44 5.1 1
(AM412317) Clostridium botulinum A str. ATCC 3502 complete g... 44 5.1 1
(AF488749) Clostridium botulinum neurotoxin BoNT gene, compl... 44 5.1 1
(AF461540) Clostridium botulinum strain Hall A-hyper putativ... 44 5.1 1
(AB443580) Clostridium botulinum bont/A gene for neurotoxin ... 44 5.1 1
(AB302879) Clostridium botulinum boNT/A gene for neurotoxin ... 44 5.1 1
>(C84223) Dictyostelium discoideum slug cDNA, clone SSB338.
Length = 499
Score = 438 bits (221), Expect = e-119
Identities = 227/230 (98%)
Strand = Plus / Plus
Query: 164 caaatgaagaagtttattatgattcaacatatttaaatagtattattactgacccaaaga 223
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 155 caaatgaagaagtttattatgattcaanatatttaaatagtattattactgacccaaaga 214
Query: 224 acccatgtatgaatgttgtttgtaccgatcaatttccaggccaatgtaatgtccgtgcag 283
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 acccatgtatgaatgttgtttgtaccgatcaatttccaggccaatgtaatgtccgtgcag 274
Query: 284 gtcaaatattttttgntngtaatactgcagtaggaatttgttgtggtgtttgtatggaac 343
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 gtcaaatattttttgtttgtaatactgcagtaggaatttgttgtggtgtttgtatggaac 334
Query: 344 ataaagatttagatccagaaactgaaccaccaaaataagttattattttt 393
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 ataaagatttagatccagaaactgaaccaccaaaataagttattattttt 384
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 102105510
Number of Hits to DB: 344,965,989
Number of extensions: 22147566
Number of successful extensions: 1419516
Number of sequences better than 10.0: 162
Length of query: 507
Length of database: 101,790,757,118
Length adjustment: 23
Effective length of query: 484
Effective length of database: 99,442,330,388
Effective search space: 48130087907792
Effective search space used: 48130087907792
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home