Homology VSG340 vs DNA
Query= VSG340 (VSG340Q) /CSM/VS/VSG3-B/VSG340Q.Seq.d/
(556 letters)
Database: ddbj_B
138,030,308 sequences; 128,745,918,079 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(AU266333) Dictyostelium discoideum vegetative cDNA clone:VS... 1053 0.0 1
(AU265495) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU263760) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU262549) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU261386) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU263021) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU261610) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU261767) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU266565) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU261641) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU262103) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU261734) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU264964) Dictyostelium discoideum vegetative cDNA clone:VS... 924 0.0 2
(BJ418298) Dictyostelium discoideum cDNA clone:ddv32d10, 5' ... 932 0.0 2
(AU266307) Dictyostelium discoideum vegetative cDNA clone:VS... 634 0.0 3
(AU269776) Dictyostelium discoideum vegetative cDNA clone:VS... 563 0.0 3
(AU263422) Dictyostelium discoideum vegetative cDNA clone:VS... 924 0.0 2
(AU267509) Dictyostelium discoideum vegetative cDNA clone:VS... 904 0.0 2
(AU267510) Dictyostelium discoideum vegetative cDNA clone:VS... 912 0.0 2
(AU265967) Dictyostelium discoideum vegetative cDNA clone:VS... 892 0.0 2
(AU267610) Dictyostelium discoideum vegetative cDNA clone:VS... 912 0.0 2
(AU262265) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU265968) Dictyostelium discoideum vegetative cDNA clone:VS... 904 0.0 2
(AU262907) Dictyostelium discoideum vegetative cDNA clone:VS... 900 0.0 2
(AU270145) Dictyostelium discoideum vegetative cDNA clone:VS... 878 0.0 2
(AU265496) Dictyostelium discoideum vegetative cDNA clone:VS... 926 0.0 2
(BJ437584) Dictyostelium discoideum cDNA clone:ddv34p14, 3' ... 900 0.0 2
(AU266308) Dictyostelium discoideum vegetative cDNA clone:VS... 912 0.0 2
(BJ436803) Dictyostelium discoideum cDNA clone:ddv32d10, 3' ... 920 0.0 2
(C25695) Dictyostelium discoideum gamete cDNA, clone FC-AY08. 910 0.0 2
(AU270146) Dictyostelium discoideum vegetative cDNA clone:VS... 884 0.0 2
(AU264946) Dictyostelium discoideum vegetative cDNA clone:VS... 579 0.0 3
(AU264965) Dictyostelium discoideum vegetative cDNA clone:VS... 922 0.0 2
(AU265769) Dictyostelium discoideum vegetative cDNA clone:VS... 912 0.0 2
(AU263761) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU267199) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU267609) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU267533) Dictyostelium discoideum vegetative cDNA clone:VS... 866 0.0 2
(AU265768) Dictyostelium discoideum vegetative cDNA clone:VS... 932 0.0 2
(AU265463) Dictyostelium discoideum vegetative cDNA clone:VS... 852 0.0 2
(AU264945) Dictyostelium discoideum vegetative cDNA clone:VS... 928 0.0 2
(AU269777) Dictyostelium discoideum vegetative cDNA clone:VS... 543 0.0 3
(BJ437691) Dictyostelium discoideum cDNA clone:ddv35f04, 3' ... 912 0.0 1
(BJ411710) Dictyostelium discoideum cDNA clone:ddv5b13, 5' e... 906 0.0 2
(AU270495) Dictyostelium discoideum vegetative cDNA clone:VS... 910 0.0 1
(BJ441949) Dictyostelium discoideum cDNA clone:ddv48h11, 3' ... 900 0.0 1
(AU270496) Dictyostelium discoideum vegetative cDNA clone:VS... 884 0.0 2
(AU267200) Dictyostelium discoideum vegetative cDNA clone:VS... 892 0.0 1
(AU265162) Dictyostelium discoideum vegetative cDNA clone:VS... 842 0.0 2
(AU265464) Dictyostelium discoideum vegetative cDNA clone:VS... 739 0.0 3
(AU265161) Dictyostelium discoideum vegetative cDNA clone:VS... 841 0.0 2
(AU266564) Dictyostelium discoideum vegetative cDNA clone:VS... 809 0.0 1
(BJ419517) Dictyostelium discoideum cDNA clone:ddv36i08, 5' ... 710 0.0 2
(AU275123) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 751 0.0 1
(AU275122) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 751 0.0 1
(AU272019) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 751 0.0 1
(AU272027) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 722 0.0 1
(AU272129) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 700 0.0 1
(AU267532) Dictyostelium discoideum vegetative cDNA clone:VS... 644 e-180 1
(AU271355) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 642 e-180 1
(AU271354) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 642 e-180 1
(AU271813) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 597 e-166 1
(AU060399) Dictyostelium discoideum slug cDNA, clone SLJ611. 533 e-147 1
(BJ438098) Dictyostelium discoideum cDNA clone:ddv36i08, 3' ... 452 e-145 2
(GR576323) CBXW1555.g1 CBXW Dictyostelium purpureum 6 hr veg... 246 e-115 3
(GR576322) CBXW1555.b1 CBXW Dictyostelium purpureum 6 hr veg... 246 e-115 3
(GR586070) CCAB1250.b1 CCAB Dictyostelium purpureum 0 hr sta... 246 e-115 3
(GR587922) CCAB559.g1 CCAB Dictyostelium purpureum 0 hr star... 246 e-115 3
(GR587921) CCAB559.b1 CCAB Dictyostelium purpureum 0 hr star... 246 e-115 3
(AU263894) Dictyostelium discoideum vegetative cDNA clone:VS... 391 e-114 2
(AU053044) Dictyostelium discoideum slug cDNA, clone SLF572. 333 e-104 2
(GR581110) CBZZ1064.g1 CBZZ Dictyostelium purpureum 18 hr st... 186 1e-96 3
(GR581109) CBZZ1064.b1 CBZZ Dictyostelium purpureum 18 hr st... 186 1e-96 3
(AU261307) Dictyostelium discoideum vegetative cDNA clone:VS... 262 6e-91 2
(AU261712) Dictyostelium discoideum vegetative cDNA clone:VS... 115 5e-31 2
(EC760814) PSE00005451 rw_mgpallid Polysphondylium pallidum ... 94 6e-30 3
(EC760835) PSE00007079 rw_mgpallid Polysphondylium pallidum ... 94 6e-30 3
(EC762424) PSE00005963 rw_mgpallid Polysphondylium pallidum ... 94 8e-30 3
(AU271814) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 137 6e-28 1
(DL131147) JP 2005507636-A/310: Bax-responsive genes for dru... 66 6e-26 4
(AX537004) Sequence 605 from Patent WO02064766. 66 6e-26 4
(AR941707) Sequence 605 from patent US 7101990. 66 6e-26 4
(AR550465) Sequence 5596 from patent US 6747137. 66 6e-26 4
(DY891101) CeleSEQ7643 Cunninghamella elegans pBluescript (E... 74 2e-23 4
(FS603734) Polypedilum vanderplanki mRNA, clone: E_ET_PVD12_... 66 7e-22 3
(FS599624) Polypedilum vanderplanki mRNA, clone: E_ET_PVD00_... 66 8e-22 3
(FS602580) Polypedilum vanderplanki mRNA, clone: E_ET_PVD12_... 66 8e-22 3
(FS605717) Polypedilum vanderplanki mRNA, clone: E_ET_PVD12_... 66 8e-22 3
(FS606874) Polypedilum vanderplanki mRNA, clone: E_ET_PVD36_... 66 9e-22 3
(FG582046) TpNBL010673 Trichinella pseudospiralis new born l... 76 2e-19 2
(CU615876) Theobroma cacao, mRNA sequence (KZ0AAN5YJ23FM1). 60 7e-19 5
(FE258658) CAPH7258.fwd CAPH Naegleria gruberi amoeba stage ... 62 1e-18 4
(FE249069) CAPH2067.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE260977) CAZO1718.fwd CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE260976) CAZO1718.rev CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE255595) CAPH5666.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255774) CAPH5764.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250598) CAPH2947.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE258896) CAPH7388.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249070) CAPH2067.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE253767) CAPH4710.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254672) CAPH5171.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE259556) CAPH7764.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248459) CAPH1704.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250801) CAPH3072.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250216) CAPH2722.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254765) CAPH5222.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254764) CAPH5222.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254313) CAPH4994.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255775) CAPH5764.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254625) CAPH5149.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249031) CAPH2045.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255209) CAPH5462.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249527) CAPH2333.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249653) CAPH2402.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE258897) CAPH7388.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE252837) CAPH4227.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE243644) CAPG7755.rev CAPG Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE259557) CAPH7764.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250599) CAPH2947.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE259601) CAPH7795.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255053) CAPH5378.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE253616) CAPH4633.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE251396) CAPH3422.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248623) CAPH1801.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE253768) CAPH4710.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254673) CAPH5171.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE260789) CAZO1585.fwd CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE260788) CAZO1585.rev CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE259930) CAPH7990.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254314) CAPH4994.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE252346) CAPH3964.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE252345) CAPH3964.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE267340) CAZO6053.rev CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE258704) CAPH7282.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE257713) CAPH6769.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255596) CAPH5666.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254874) CAPH528.fwd CAPH Naegleria gruberi amoeba stage N... 62 2e-18 4
(FE254873) CAPH528.rev CAPH Naegleria gruberi amoeba stage N... 62 2e-18 4
(FE251753) CAPH3637.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE264992) CAZO4196.fwd CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE264991) CAZO4196.rev CAZO Naegleria gruberi Flagellate St... 62 2e-18 4
(FE247088) CAPG9767.rev CAPG Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250802) CAPH3072.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248460) CAPH1704.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254626) CAPH5149.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249528) CAPH2333.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE249032) CAPH2045.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE255210) CAPH5462.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE251397) CAPH3422.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE252838) CAPH4227.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248793) CAPH1900.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248792) CAPH1900.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE259602) CAPH7795.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE243645) CAPG7755.fwd CAPG Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE253465) CAPH455.fwd CAPH Naegleria gruberi amoeba stage N... 62 2e-18 4
(FE253464) CAPH455.rev CAPH Naegleria gruberi amoeba stage N... 62 2e-18 4
(FE249654) CAPH2402.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254930) CAPH5310.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE254929) CAPH5310.rev CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE248624) CAPH1801.fwd CAPH Naegleria gruberi amoeba stage ... 62 2e-18 4
(FE250217) CAPH2722.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE241734) CAPG683.fwd CAPG Naegleria gruberi amoeba stage N... 62 3e-18 4
(FE241733) CAPG683.rev CAPG Naegleria gruberi amoeba stage N... 62 3e-18 4
(FE256659) CAPH6224.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE256658) CAPH6224.rev CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE255054) CAPH5378.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE253617) CAPH4633.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE252137) CAPH3853.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE252136) CAPH3853.rev CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE259931) CAPH7990.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE251754) CAPH3637.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE257714) CAPH6769.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE258705) CAPH7282.fwd CAPH Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE247089) CAPG9767.fwd CAPG Naegleria gruberi amoeba stage ... 62 3e-18 4
(FE267960) CAZO6450.rev CAZO Naegleria gruberi Flagellate St... 62 5e-18 4
(FE264729) CAZO4039.fwd CAZO Naegleria gruberi Flagellate St... 62 4e-17 4
(AL402826) T7 end of clone AT0AA004H11 of library AT0AA from... 74 2e-16 2
(EZ955772) TSA: Bemisia tabaci BT_Q_ZJU_Singletons159842 mRN... 58 4e-16 3
(DL263604) JP 2008511305-A/671: METHODS FOR ANALYZING GENES ... 70 2e-15 3
(DJ130053) JP 2007228956-A/671: Method for identification of... 70 2e-15 3
(HB142319) Sequence 673 from Patent WO2006024951. 70 2e-15 3
(HA138972) Sequence 673 from Patent WO2006024892. 70 2e-15 3
(FU775154) JP 2009528046-A/671: Method for identifying usefu... 70 2e-15 3
(HO081713) ms_bjs_1a38_1_cam15_60_b08.nt Campoletis sonorens... 80 3e-15 2
(AL392519) T3 end of clone AR0AA005C02 of library AR0AA from... 76 9e-15 3
(AL398924) T7 end of clone AS0AA012A08 of library AS0AA from... 78 1e-14 2
(CR382136) Debaryomyces hansenii strain CBS767 chromosome A ... 92 1e-14 8
(GR017851) CCIC7409.g1 CCIC Mimulus guttatus IM62 roots (H) ... 52 3e-14 3
(GR017850) CCIC7409.b1 CCIC Mimulus guttatus IM62 roots (H) ... 52 3e-14 3
(GR046489) CCIC22935.g1 CCIC Mimulus guttatus IM62 roots (H)... 52 3e-14 3
(GR046488) CCIC22935.b1 CCIC Mimulus guttatus IM62 roots (H)... 52 3e-14 3
(GR040538) CCIC19654.b1 CCIC Mimulus guttatus IM62 roots (H)... 52 3e-14 3
(GR039943) CCIC19330.b1 CCIC Mimulus guttatus IM62 roots (H)... 52 3e-14 3
(FM992690) Candida dubliniensis CD36 chromosome 3, complete ... 66 3e-14 7
(CV176963) PANORPA45PCR_F08_1_063 Panorpa vulgaris cDNA Pano... 62 4e-14 3
(CV177311) PANORPA4POLYT_F08_1_063 Panorpa vulgaris cDNA Pan... 62 5e-14 3
(AZ974567) 2M0249O11F Mouse 10kb plasmid UUGC2M library Mus ... 80 4e-13 2
(FE247979) CAPH1417.fwd CAPH Naegleria gruberi amoeba stage ... 62 1e-12 3
(DV183843) CT027_G07_CT027_3700_90.ab1 C. tentans tissue cul... 62 2e-12 2
(FE850433) CAFP1176.fwd CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(CB039089) Tc_ad2_53E11_TEXF1 Teladorsagia circumcincta adul... 86 2e-12 1
(CB038824) Tc_ad2_50E03_TEXF1 Teladorsagia circumcincta adul... 86 2e-12 1
(CB038812) Tc_ad2_50C12_TEXF1 Teladorsagia circumcincta adul... 86 2e-12 1
(CB038341) Tc_ad2_44F06_TEXF1 Teladorsagia circumcincta adul... 86 2e-12 1
(FE856822) CAFU835.rev CAFU Pichia stipitis oxygen limited d... 46 2e-12 3
(FE851730) CAFP1873.rev CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE845725) CAFI1122.rev CAFI Pichia stipitis aerobic dextros... 46 2e-12 3
(FE860707) CAFY773.rev CAFY Pichia stipitis oxygen limited x... 46 2e-12 3
(FE845846) CAFI419.rev CAFI Pichia stipitis aerobic dextrose... 46 2e-12 3
(FE856823) CAFU835.fwd CAFU Pichia stipitis oxygen limited d... 46 2e-12 3
(FE851731) CAFP1873.fwd CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE850432) CAFP1176.rev CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE850488) CAFP1205.rev CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE860708) CAFY773.fwd CAFY Pichia stipitis oxygen limited x... 46 2e-12 3
(FE851799) CAFP1910.fwd CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE851798) CAFP1910.rev CAFP Pichia stipitis aerobic xylose ... 46 2e-12 3
(FE845726) CAFI1122.fwd CAFI Pichia stipitis aerobic dextros... 46 2e-12 3
(FE855774) CAFU1045.fwd CAFU Pichia stipitis oxygen limited ... 46 2e-12 3
(FE845847) CAFI419.fwd CAFI Pichia stipitis aerobic dextrose... 46 2e-12 3
(FE855773) CAFU1045.rev CAFU Pichia stipitis oxygen limited ... 46 2e-12 3
(FE850489) CAFP1205.fwd CAFP Pichia stipitis aerobic xylose ... 46 3e-12 3
(GR040539) CCIC19654.g1 CCIC Mimulus guttatus IM62 roots (H)... 44 5e-12 3
(EC010492) 1069655 JF08 Tribolium castaneum cDNA clone 51568... 78 2e-11 2
(DN646837) G7008.17 Exelixis Tribolium castaneum cDNA Librar... 78 2e-11 2
(CB334917) Tc001G10F Tribolium castaneum embryonic cDNA libr... 78 2e-11 2
(EB723424) PMAO-aac30b04.b1 Lamprey_EST_Embryo Petromyzon ma... 78 2e-11 2
(CB336086) Tc013A07R Tribolium castaneum embryonic cDNA libr... 78 2e-11 2
(EB752334) 986490 JF06 Tribolium castaneum cDNA clone 502317... 78 2e-11 2
(DN646834) G6662.87 Exelixis Tribolium castaneum cDNA Librar... 78 2e-11 2
(GH457992) CCUA1765.g1 CCUA Peromyscus polionotus subgrisieu... 80 2e-11 2
(GH457991) CCUA1765.b1 CCUA Peromyscus polionotus subgrisieu... 80 2e-11 2
(GH539815) CCUH5390.b1 CCUH Peromyscus maniculatus bairdii B... 80 3e-11 2
(GH534017) CCUH2342.b1 CCUH Peromyscus maniculatus bairdii B... 80 3e-11 2
(GH539298) CCUH5131.g1 CCUH Peromyscus maniculatus bairdii B... 80 3e-11 2
(GH539297) CCUH5131.b1 CCUH Peromyscus maniculatus bairdii B... 80 3e-11 2
(CB334918) Tc001G10R Tribolium castaneum embryonic cDNA libr... 78 3e-11 2
(EV469977) PM_BWt0011H06f PM_BWtestis Peromyscus maniculatus... 80 3e-11 2
(AL407551) T7 end of clone AV0AA003A02 of library AV0AA from... 54 4e-11 2
(AI013591) EST208266 Normalized rat spleen, Bento Soares Rat... 68 6e-11 2
(AL662926) Mouse DNA sequence from clone RP23-403O15 on chro... 80 7e-11 2
(BQ203516) UI-R-DZ1-cnf-l-08-0-UI.s1 NCI_CGAP_DZ1 Rattus nor... 68 9e-11 2
(BQ192699) UI-R-DR1-cla-b-19-0-UI.s1 UI-R-DR1 Rattus norvegi... 68 1e-10 2
(AC123854) Mus musculus BAC clone RP23-328J8 from chromosome... 80 1e-10 1
(AC122872) Mus musculus BAC clone RP23-110E8 from 1, complet... 80 1e-10 1
(GH534669) CCUH2699.g1 CCUH Peromyscus maniculatus bairdii B... 80 1e-10 1
(GH534668) CCUH2699.b1 CCUH Peromyscus maniculatus bairdii B... 80 1e-10 1
(GH524862) CCUG568.g1 CCUG Peromyscus maniculatus bairdii BW... 80 1e-10 1
(GH498567) CCUC7610.g1 CCUC Peromyscus maniculatus bairdii B... 80 1e-10 1
(GH498566) CCUC7610.b1 CCUC Peromyscus maniculatus bairdii B... 80 1e-10 1
(GH496825) CCUC6712.g1 CCUC Peromyscus maniculatus bairdii B... 80 1e-10 1
(GH496824) CCUC6712.b1 CCUC Peromyscus maniculatus bairdii B... 80 1e-10 1
(CU928176) Zygosaccharomyces rouxii strain CBS732 chromosome... 76 2e-10 3
(AW507406) EST00211 Plasmid Subtractive Library of Rat Cereb... 70 2e-10 2
(CB770658) AMGNNUC:TRGS2-00002-A11-A trgs2 (10306) Rattus no... 70 2e-10 2
(AI237692) EST234254 Normalized rat placenta, Bento Soares R... 70 3e-10 2
(AW920345) EST351649 Rat gene index, normalized rat, norvegi... 70 3e-10 2
(AI008704) EST203155 Normalized rat embryo, Bento Soares Rat... 70 3e-10 2
(BE128710) DEPA2460 Rat Lambda ZAP Express Library Rattus no... 70 3e-10 2
(CB727920) AMGNNUC:NRDG1-00001-B5-A nrdg1 (10855) Rattus nor... 70 3e-10 2
(AW140823) EST290905 Normalized rat embryo, Bento Soares Rat... 70 3e-10 2
(CB713566) AMGNNUC:CDRG1-00023-E2-A cdrg1 (10898) Rattus nor... 70 3e-10 2
(CB712032) AMGNNUC:NRDG1-00182-H5-A nrdg1 (10855) Rattus nor... 70 3e-10 2
(CB783359) AMGNNUC:NRDG1-00118-F4-A nrdg1 (10855) Rattus nor... 70 3e-10 2
(BE126905) DEPA0653 Rat Lambda ZAP Express Library Rattus no... 70 3e-10 2
(AA818753) UI-R-A0-ay-a-10-0-UI.s1 UI-R-A0 Rattus norvegicus... 70 3e-10 2
(AI170643) EST216577 Normalized rat muscle, Bento Soares Rat... 70 3e-10 2
(BI288852) UI-R-DK0-cdf-f-06-0-UI.s1 UI-R-DK0 Rattus norvegi... 70 3e-10 2
(DJ006055) JP 2007501617-A/1638: Primary rat hepatocyte toxi... 70 3e-10 2
(DD315196) JP 2006502693-A/1886: Primary Rat Hepatocyte Toxi... 70 3e-10 2
(GP047257) Sequence 1886 from patent US 7469185. 70 3e-10 2
(AI103105) EST212394 Normalized rat embryo, Bento Soares Rat... 70 3e-10 2
(BI298393) UI-R-CV2-cho-g-08-0-UI.s1 UI-R-CV2 Rattus norvegi... 70 3e-10 2
(BF410900) UI-R-CN0-bmf-d-05-0-UI.s1 UI-R-CN0 Rattus norvegi... 70 3e-10 2
(CB614151) AMGNNUC:URRG1-00028-G1-A urrg1 (14046) Rattus nor... 70 3e-10 2
(CB610033) AMGNNUC:NRDG1-00137-A2-A nrdg1 (10855) Rattus nor... 70 3e-10 2
(CB609650) AMGNNUC:NRDG1-00172-H9-A nrdg1 (10855) Rattus nor... 70 3e-10 2
(CB616401) AMGNNUC:CDRG1-00017-C4-A cdrg1 (10898) Rattus nor... 70 3e-10 2
(BQ210949) UI-R-DY1-coj-g-03-0-UI.s1 NCI_CGAP_DY1 Rattus nor... 70 3e-10 2
(BE111079) UI-R-BJ1-auz-d-06-0-UI.s1 UI-R-BJ1 Rattus norvegi... 70 3e-10 2
(BI742717) kx34d04.y1 Parastrongyloides trichosuri IL pAMP1 ... 56 3e-10 3
(CD372809) UI-R-GR0-csv-e-21-0-UI.r1 UI-R-GR0 Rattus norvegi... 70 4e-10 2
(FL636231) TG_302_D12 Termite gut library Reticulitermes fla... 58 4e-10 2
(BG374288) UI-R-CV1-bsn-f-03-0-UI.s1 UI-R-CV1 Rattus norvegi... 70 4e-10 2
(BI743117) kx38h12.y1 Parastrongyloides trichosuri IL pAMP1 ... 56 4e-10 3
(DY451532) PCAA-aaa02f12.g1 UCI-12 Podocoryna carnea cDNA 5'... 50 4e-10 3
(CD373331) UI-R-GR0-csv-b-06-0-UI.r1 UI-R-GR0 Rattus norvegi... 70 4e-10 2
(BM384327) UI-R-DY0-ckr-j-24-0-UI.s1 NCI_CGAP_DY0 Rattus nor... 70 4e-10 2
(CF977827) F29G09_067.ab1.R Rat retinal ganglion cell Rattus... 70 4e-10 2
(FL637686) TG_03_E12 Termite gut library Reticulitermes flav... 58 4e-10 2
(BG380652) UI-R-CT0-btz-g-11-0-UI.s1 UI-R-CT0 Rattus norvegi... 70 4e-10 2
(X53504) Rat mRNA for ribosomal protein L12. 70 4e-10 2
(DM013950) JP 2008188014-A/544: Surrogate Markers of Neuropa... 70 4e-10 2
(DM013610) JP 2008188014-A/204: Surrogate Markers of Neuropa... 70 4e-10 2
(DM013609) JP 2008188014-A/203: Surrogate Markers of Neuropa... 70 4e-10 2
(DL486286) JP 2008148706-A/1497: Molecular Toxicology Modeling. 70 4e-10 2
(DL003801) JP 2007536913-A/544: Surrogate Markers of Neuropa... 70 4e-10 2
(DL003461) JP 2007536913-A/204: Surrogate Markers of Neuropa... 70 4e-10 2
(DL003460) JP 2007536913-A/203: Surrogate Markers of Neuropa... 70 4e-10 2
(DL002422) JP 2007535305-A/1537: Methods for Molecular Toxic... 70 4e-10 2
(DJ019585) JP 2006507006-A/1537: Molecular Nephrotoxicology ... 70 4e-10 2
(DD317740) JP 2006502693-A/4430: Primary Rat Hepatocyte Toxi... 70 4e-10 2
(DD270805) JP 2005535285-A/4216: Molecular Hepatotoxicology ... 70 4e-10 2
(DD193888) JP 2005517400-A/422: Cardiotoxin Molecular Toxico... 70 4e-10 2
(DD041463) JP 2004522411-A/1497: Molecular Toxicology Modeling. 70 4e-10 2
(CS164678) Sequence 866 from Patent WO2005083125. 70 4e-10 2
(CS164016) Sequence 204 from Patent WO2005083125. 70 4e-10 2
(CS164015) Sequence 203 from Patent WO2005083125. 70 4e-10 2
(BD317323) JP 2003159059-A/52: Identification and Use of Mol... 70 4e-10 2
(AX700335) Sequence 104 from Patent EP1284297. 70 4e-10 2
(AX401821) Sequence 1497 from Patent WO0210453. 70 4e-10 2
(GX282513) Sequence 139 from patent US 7739056. 70 4e-10 2
(GP576267) Sequence 2443 from patent US 7590493. 70 4e-10 2
(GP049801) Sequence 4430 from patent US 7469185. 70 4e-10 2
(GM753852) Sequence 866 from Patent EP1980628. 70 4e-10 2
(GM753190) Sequence 204 from Patent EP1980628. 70 4e-10 2
(GM753189) Sequence 203 from Patent EP1980628. 70 4e-10 2
(GC672062) Sequence 2654 from patent US 7447594. 70 4e-10 2
(GC590831) Sequence 2164 from patent US 7426441. 70 4e-10 2
(GC554845) Sequence 2164 from patent US 7415358. 70 4e-10 2
(FW511572) JP 2007533005-A/1056: HEPATOTOXICITY MOLECULAR MO... 70 4e-10 2
(FW511571) JP 2007533005-A/1055: HEPATOTOXICITY MOLECULAR MO... 70 4e-10 2
(BQ208850) UI-R-DY1-cns-c-06-0-UI.s1 NCI_CGAP_DY1 Rattus nor... 70 4e-10 2
(CA508902) UI-R-FS0-cqm-n-07-0-UI.s1 NCI_CGAP_FS0 Rattus nor... 68 4e-10 2
(BG378603) UI-R-CV1-bvr-d-09-0-UI.s1 UI-R-CV1 Rattus norvegi... 70 4e-10 2
(CN543113) UI-R-DZ1-cnf-c-19-0-UI.s1 NCI_CGAP_DZ1 Rattus nor... 70 4e-10 2
(CV798037) UI-R-DY1-com-b-14-0-UI.s1 UI-R-DY1 Rattus norvegi... 70 4e-10 2
(AW913942) EST292159 Rat gene index, normalized rat, norvegi... 70 4e-10 2
(CO144450) EST839121 Aspergillus flavus Normalized cDNA Expr... 70 4e-10 2
(BQ210240) UI-R-DY1-coh-b-08-0-UI.s1 NCI_CGAP_DY1 Rattus nor... 70 4e-10 2
(CF110975) Shultzomica04226 Rat lung airway and parenchyma c... 70 4e-10 2
(BQ204006) UI-R-DN1-cmv-g-07-0-UI.s1 UI-R-DN1 Rattus norvegi... 70 4e-10 2
(DJ007079) JP 2007501617-A/2662: Primary rat hepatocyte toxi... 70 4e-10 2
(BQ210948) UI-R-DY1-coj-g-01-0-UI.s1 NCI_CGAP_DY1 Rattus nor... 70 4e-10 2
(BI279510) UI-R-DA0-byo-d-05-0-UI.s1 UI-R-DA0 Rattus norvegi... 70 4e-10 2
(BI279327) UI-R-DA0-byn-a-06-0-UI.s1 UI-R-DA0 Rattus norvegi... 70 4e-10 2
(CB323430) UI-R-DY0-crf-k-13-0-UI.s1 NCI_CGAP_DY0 Rattus nor... 70 4e-10 2
(CB323595) UI-R-DY0-crf-n-21-0-UI.s1 NCI_CGAP_DY0 Rattus nor... 70 4e-10 2
(DN932649) AGENCOURT_50138326 NCI_CGAP_Pr49 Rattus norvegicu... 70 4e-10 2
(DY452965) PCAA-aaa40d09.g1 UCI-12 Podocoryna carnea cDNA 5'... 50 5e-10 3
(EB751543) 990033 JF06 Tribolium castaneum cDNA clone 501944... 78 5e-10 1
(DN646833) G6640.77 Exelixis Tribolium castaneum cDNA Librar... 78 5e-10 1
(CB337182) Tc027C11R Tribolium castaneum embryonic cDNA libr... 78 5e-10 1
(CB336099) Tc013B10R Tribolium castaneum embryonic cDNA libr... 78 5e-10 1
(CB038898) Tc_ad2_51D03_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB038807) Tc_ad2_50C07_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB038580) Tc_ad2_47F08_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB038431) Tc_ad2_45G03_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB038078) Tc_ad2_41F04_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB037843) Tc_ad2_38H01_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB036264) Tc_ad2_19F10_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB036263) Tc_ad2_19F09_TEXF1 Teladorsagia circumcincta adul... 78 5e-10 1
(CB314878) AGENCOURT_11520160 NICHD_Rr_Pit1 Rattus norvegicu... 70 6e-10 2
(FE845550) CAFI1026.rev CAFI Pichia stipitis aerobic dextros... 46 8e-10 3
(CB698535) AMGNNUC:TRGS2-00014-F3-A trgs2 (10306) Rattus nor... 68 9e-10 2
(BG663809) DRAAANH07 Rat DRG Library Rattus norvegicus cDNA ... 68 9e-10 2
(CB763363) AMGNNUC:TRBA1-00003-H10-A trba1 (10260) Rattus no... 68 9e-10 2
(FM056783) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(BP488405) Rattus norvegicus mRNA, clone:RI05525, 3' end, ex... 68 1e-09 2
(FM067926) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(CK149970) CsmgEST00666 Culicoides sonorensis female serum-f... 58 1e-09 2
(FM051963) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(DL263555) JP 2008511305-A/622: METHODS FOR ANALYZING GENES ... 58 1e-09 2
(DJ130004) JP 2007228956-A/622: Method for identification of... 58 1e-09 2
(HB142270) Sequence 624 from Patent WO2006024951. 58 1e-09 2
(HA138923) Sequence 624 from Patent WO2006024892. 58 1e-09 2
(FU775105) JP 2009528046-A/622: Method for identifying usefu... 58 1e-09 2
(FM044169) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(CB612613) AMGNNUC:NRDG1-00147-F7-A nrdg1 (10855) Rattus nor... 68 1e-09 2
(BP489103) Rattus norvegicus mRNA, clone:RI06294, 3' end, ex... 68 1e-09 2
(BP493628) Rattus norvegicus mRNA, clone:RI11351, 3' end, ex... 68 1e-09 2
(FM048005) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(BQ201260) UI-R-DQ1-clt-n-03-0-UI.s1 UI-R-DQ1 Rattus norvegi... 68 1e-09 2
(CD373032) UI-R-GR0-csv-p-05-0-UI.r1 UI-R-GR0 Rattus norvegi... 68 1e-09 2
(FM055438) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(FM053803) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(GT278211) pmaximaP0002N01_517 Adult silver lipped oyster (P... 60 1e-09 3
(BQ190268) UI-R-DN1-ckg-n-07-0-UI.s1 UI-R-DN1 Rattus norvegi... 68 1e-09 2
(FM064547) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(FM055099) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(FN803620) Rattus norvegicus EST, clone etcmembP0029H11, str... 68 1e-09 2
(FM062566) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(CD372792) UI-R-GR0-csv-c-07-0-UI.r1 UI-R-GR0 Rattus norvegi... 68 1e-09 2
(FN803618) Rattus norvegicus EST, clone etcmembP0007A11, str... 68 1e-09 2
(FM040856) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(FM060207) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(FM064166) Rattus norvegicus EST, 5'-end sequence, clone etc... 68 1e-09 2
(CN541227) UI-R-DZ0-cmz-i-03-0-UI.s1 NCI_CGAP_DZ0 Rattus nor... 68 1e-09 2
(FN803617) Rattus norvegicus EST, clone etcmembP0024N21, str... 68 1e-09 2
(GT280005) pmaximaP0009K09_554 Adult silver lipped oyster (P... 60 2e-09 3
(CB322861) UI-R-DZ0-crm-c-17-0-UI.s1 NCI_CGAP_DZ0 Rattus nor... 68 2e-09 2
(FQ134240) Rattus norvegicus mRNA 5-prime sequence from clon... 68 2e-09 2
(CB328083) UI-R-FS0-cry-h-16-0-UI.s1 NCI_CGAP_FS0 Rattus nor... 68 2e-09 2
(BP477251) Rattus norvegicus mRNA, clone:RBC14544, 3' end, e... 68 2e-09 2
(FN803619) Rattus norvegicus EST, clone etcmembP0028D05, str... 68 2e-09 2
(CX570153) RVL1276 Wackym-Soares normalized rat vestibular c... 68 2e-09 2
(CX570136) RVL1256 Wackym-Soares normalized rat vestibular c... 68 2e-09 2
(BP467874) Rattus norvegicus mRNA, clone:RBC02044, 3' end, e... 68 2e-09 2
(CO555865) AGENCOURT_28626335 NIH_MGC_249 Rattus norvegicus ... 68 2e-09 2
(FQ236198) Rattus norvegicus mRNA 5-prime sequence from clon... 68 2e-09 2
(CA505378) UI-R-FS1-cqf-k-17-0-UI.s1 NCI_CGAP_FS1 Rattus nor... 68 2e-09 2
(CB326749) UI-R-DZ0-crq-l-16-0-UI.s1 NCI_CGAP_DZ0 Rattus nor... 68 2e-09 2
(BP491673) Rattus norvegicus mRNA, clone:RI09166, 3' end, ex... 68 2e-09 2
(CO383172) AGENCOURT_26627066 NIH_MGC_253 Rattus norvegicus ... 68 2e-09 2
(BQ199946) UI-R-DQ1-cli-d-04-0-UI.s1 UI-R-DQ1 Rattus norvegi... 68 2e-09 2
(EV776745) AGENCOURT_113689374 NIH_MGC_431 Rattus norvegicus... 68 2e-09 2
(BC166903) Rattus norvegicus similar to 60S ribosomal protei... 68 2e-09 2
(FQ183287) Rattus norvegicus mRNA 5-prime sequence from clon... 68 2e-09 2
(GT284445) pmaximaP0028M24_591 Adult silver lipped oyster (P... 60 2e-09 3
(CO383896) AGENCOURT_26625171 NIH_MGC_253 Rattus norvegicus ... 68 2e-09 2
(GT284306) pmaximaP0028D11_621 Adult silver lipped oyster (P... 60 2e-09 3
(FP490583) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(EZ420233) TSA: Pinctada maxima PmaxCL106Contig1, mRNA seque... 60 2e-09 3
(GT281449) pmaximaP0014N24_625 Adult silver lipped oyster (P... 60 2e-09 3
(GO204203) CAGB19942.rev CAGB Alvinella pompejana Normalized... 50 2e-09 3
(AV149999) Mus musculus adult male hippocampus cDNA, partial... 76 2e-09 1
(FP530930) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(GO204204) CAGB19942.fwd CAGB Alvinella pompejana Normalized... 50 2e-09 3
(GO152067) CAGA35139.fwd CAGA Alvinella pompejana Normalized... 50 2e-09 3
(GO152066) CAGA35139.rev CAGA Alvinella pompejana Normalized... 50 2e-09 3
(FP543942) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP536403) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(GO234559) CAGB9531.fwd CAGB Alvinella pompejana Normalized ... 50 2e-09 3
(GO234558) CAGB9531.rev CAGB Alvinella pompejana Normalized ... 50 2e-09 3
(FP537652) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP555099) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531542) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531121) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP530414) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP533914) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP512529) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531987) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP533657) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP532009) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP536153) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP539028) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537984) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP535742) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP534392) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP536193) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP533104) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531056) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP528049) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(GO129329) CAGA23716.rev CAGA Alvinella pompejana Normalized... 50 2e-09 3
(FP539511) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP538895) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP532615) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP532500) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP532372) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(GO129330) CAGA23716.fwd CAGA Alvinella pompejana Normalized... 50 2e-09 3
(FP531923) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP530776) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP536823) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP536239) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP534627) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP538886) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP535646) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531246) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP527079) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP538510) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP532802) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP534709) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP535537) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537903) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531369) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537354) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP512244) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537999) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537393) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP530726) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531982) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537928) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP533900) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP533728) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP538402) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP537152) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP535898) Alvinella pompejana mRNA 5-prime sequence from cl... 50 2e-09 3
(FP531748) Alvinella pompejana mRNA 5-prime sequence from cl... 50 3e-09 3
(FP535270) Alvinella pompejana mRNA 5-prime sequence from cl... 50 3e-09 3
(GT279845) pmaximaP0009B17_736 Adult silver lipped oyster (P... 60 3e-09 3
(FP536663) Alvinella pompejana mRNA 5-prime sequence from cl... 50 3e-09 3
(ES468676) AH19C11.G Brachionus plicatilis NHIL unnormalized... 62 3e-09 2
(ES468716) AH19G07.G Brachionus plicatilis NHIL unnormalized... 62 3e-09 2
(ES468015) AH12D08.G Brachionus plicatilis NHIL unnormalized... 62 3e-09 2
(BJ979582) Brachionus plicatilis NH1L mRNA, clone: BpA0104, ... 62 3e-09 2
(FM930387) Brachionus plicatilis EST 5' end, clone sb103P004... 62 3e-09 2
(FM932349) Brachionus plicatilis EST 5' end, clone sb104P000... 62 3e-09 2
(FM918150) Brachionus plicatilis EST 5' end, clone sb102P004... 62 3e-09 2
(FM929270) Brachionus plicatilis EST 5' end, clone sb103P004... 62 3e-09 2
(FM908467) Brachionus plicatilis EST 5' end, clone sb101P004... 62 3e-09 2
(FM918395) Brachionus plicatilis EST 5' end, clone sb102P004... 62 3e-09 2
(FM914631) Brachionus plicatilis EST 5' end, clone sb102P001... 62 3e-09 2
(FM933219) Brachionus plicatilis EST 5' end, clone sb104P001... 62 3e-09 2
(FM933466) Brachionus plicatilis EST 5' end, clone sb104P001... 62 3e-09 2
(FM935787) Brachionus plicatilis EST 5' end, clone sb104P002... 62 3e-09 2
(FM899595) Brachionus plicatilis EST 5' end, clone sb101P000... 62 3e-09 2
(FM918810) Brachionus plicatilis EST 5' end, clone sb102P004... 62 3e-09 2
(DK924346) Cryptosporidium parvum cDNA, clone: XCPa005674, 5... 52 3e-09 3
(BE126406) DEPA0049 Rat Lambda ZAP Express Library Rattus no... 66 3e-09 2
(CB779218) AMGNNUC:TRGS2-00013-B12-A trgs2 (10306) Rattus no... 66 3e-09 2
>(AU266333) Dictyostelium discoideum vegetative cDNA clone:VSG340, 5' end
single read.
Length = 546
Score = 1053 bits (531), Expect = 0.0
Identities = 531/531 (100%)
Strand = Plus / Plus
Query: 1 tccaaagtagatccaagcgaaaaagttgaagtcttcctcagagtatgtggtggtgaagct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 tccaaagtagatccaagcgaaaaagttgaagtcttcctcagagtatgtggtggtgaagct 60
Query: 61 ggtgctatgtccacccttgcaccaaaactcggtccactcggtgtttcaccaaagaaagtt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ggtgctatgtccacccttgcaccaaaactcggtccactcggtgtttcaccaaagaaagtt 120
Query: 121 ggtgatgatatcgctaaagccactcaaccatggaaaggtatgaaggtttcagtcaaattg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggtgatgatatcgctaaagccactcaaccatggaaaggtatgaaggtttcagtcaaattg 180
Query: 181 accattcaaaatcgtattgctgtcccagaagttttaccatctgcttcagcattggtcatc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 accattcaaaatcgtattgctgtcccagaagttttaccatctgcttcagcattggtcatc 240
Query: 241 aaagccttaaaagagccaccaagagacagaaagaaggaaaagaacattaaacacaacggt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 aaagccttaaaagagccaccaagagacagaaagaaggaaaagaacattaaacacaacggt 300
Query: 301 aacatcccattagaagaaatctgcaaaatcgccaagaccatgagattcaaatctttagct 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 aacatcccattagaagaaatctgcaaaatcgccaagaccatgagattcaaatctttagct 360
Query: 361 gttgacttcaaaggttcagtcttagaaatcttaggtactgctcactctgttggttgtaaa 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 gttgacttcaaaggttcagtcttagaaatcttaggtactgctcactctgttggttgtaaa 420
Query: 421 gtcaatggtaaatcaccaagagatatccaagctggtatccaatctggtgaaattcgaagt 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 gtcaatggtaaatcaccaagagatatccaagctggtatccaatctggtgaaattcgaagt 480
Query: 481 tgtcgaaccaaaataaactatttaaactcaaaattttaaatataaatataa 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481 tgtcgaaccaaaataaactatttaaactcaaaattttaaatataaatataa 531
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 138030308
Number of Hits to DB: 822,141,952
Number of extensions: 50625777
Number of successful extensions: 4648607
Number of sequences better than 10.0: 11722
Length of query: 556
Length of database: 128,745,918,079
Length adjustment: 24
Effective length of query: 532
Effective length of database: 125,433,190,687
Effective search space: 66730457445484
Effective search space used: 66730457445484
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home