Homology SSC884 vs DNA
Query= SSC884 (SSC884Q) /CSM/SS/SSC8-D/SSC884Q.Seq.d/
(727 letters)
Database: ddbj_B
120,034,097 sequences; 115,169,689,543 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(AJ000063) Dictyostelium discoideum mRNA for ADP-ribosylatio... 1273 0.0 2
(C93981) Dictyostelium discoideum slug cDNA, clone SSC884. 1273 0.0 2
(C24683) Dictyostelium discoideum slug cDNA, clone SL-X091. 1273 0.0 2
(AU051887) Dictyostelium discoideum slug cDNA, clone SSC323. 1269 0.0 1
(AU061437) Dictyostelium discoideum slug cDNA, clone SLE250. 1267 0.0 1
(C94415) Dictyostelium discoideum slug cDNA, clone SSK773. 1265 0.0 1
(C93094) Dictyostelium discoideum slug cDNA, clone SSF795. 1265 0.0 1
(C91936) Dictyostelium discoideum slug cDNA, clone SSC288. 1265 0.0 1
(AU051939) Dictyostelium discoideum slug cDNA, clone SSC436. 1261 0.0 1
(C90712) Dictyostelium discoideum slug cDNA, clone SSJ855. 1259 0.0 1
(C94505) Dictyostelium discoideum slug cDNA, clone SSL113. 1257 0.0 1
(AU034097) Dictyostelium discoideum slug cDNA, clone SLB738. 1247 0.0 1
(C90254) Dictyostelium discoideum slug cDNA, clone SSI502. 1237 0.0 1
(C89750) Dictyostelium discoideum slug cDNA, clone SSG749. 1217 0.0 1
(C94519) Dictyostelium discoideum slug cDNA, clone SSL154. 1179 0.0 2
(C91294) Dictyostelium discoideum slug cDNA, clone SSK216. 1176 0.0 1
(C90527) Dictyostelium discoideum slug cDNA, clone SSI674. 1176 0.0 1
(C91233) Dictyostelium discoideum slug cDNA, clone SSJ475. 1174 0.0 1
(C91914) Dictyostelium discoideum slug cDNA, clone SSC212. 1162 0.0 1
(C94503) Dictyostelium discoideum slug cDNA, clone SSL110. 1128 0.0 1
(AU284499) Dictyostelium discoideum gamete cDNA clone:FC-BA0... 1088 0.0 1
(AU076353) Dictyostelium discoideum slug cDNA, clone SSA636. 1088 0.0 2
(C90233) Dictyostelium discoideum slug cDNA, clone SSI437. 1088 0.0 3
(C90819) Dictyostelium discoideum slug cDNA, clone SSJ184. 573 0.0 4
(AU263301) Dictyostelium discoideum vegetative cDNA clone:VS... 1047 0.0 1
(C93416) Dictyostelium discoideum slug cDNA, clone SSM817. 1037 0.0 1
(C92653) Dictyostelium discoideum slug cDNA, clone SSF688. 1033 0.0 1
(C94061) Dictyostelium discoideum slug cDNA, clone SSG352. 1023 0.0 1
(C91947) Dictyostelium discoideum slug cDNA, clone SSC540. 1023 0.0 1
(C91547) Dictyostelium discoideum slug cDNA, clone SSK424. 1013 0.0 1
(AU051959) Dictyostelium discoideum slug cDNA, clone SSC481. 686 0.0 2
(C93798) Dictyostelium discoideum slug cDNA, clone SSL730. 533 0.0 2
(C89845) Dictyostelium discoideum slug cDNA, clone SSG253. 975 0.0 1
(C90875) Dictyostelium discoideum slug cDNA, clone SSJ256. 815 0.0 3
(C90784) Dictyostelium discoideum slug cDNA, clone SSJ144. 609 0.0 3
(C93366) Dictyostelium discoideum slug cDNA, clone SSM705. 870 0.0 2
(AU275047) Dictyostelium discoideum gamete cDNA clone:FC-IC1... 884 0.0 2
(C25587) Dictyostelium discoideum slug cDNA, clone SSA220. 890 0.0 1
(C92428) Dictyostelium discoideum slug cDNA, clone SSE534. 864 0.0 1
(AU051811) Dictyostelium discoideum slug cDNA, clone SSA814. 755 0.0 1
(AU037408) Dictyostelium discoideum slug cDNA, clone SSD602. 743 0.0 1
(AU051856) Dictyostelium discoideum slug cDNA, clone SSB311. 728 0.0 1
(AU270801) Dictyostelium discoideum vegetative cDNA clone:VS... 700 0.0 1
(GR587950) CCAB581.g1 CCAB Dictyostelium purpureum 0 hr star... 674 0.0 1
(GR587949) CCAB581.b1 CCAB Dictyostelium purpureum 0 hr star... 674 0.0 1
(GR586600) CCAB1991.g1 CCAB Dictyostelium purpureum 0 hr sta... 674 0.0 1
(GR586599) CCAB1991.b1 CCAB Dictyostelium purpureum 0 hr sta... 674 0.0 1
(GR586243) CCAB1371.b1 CCAB Dictyostelium purpureum 0 hr sta... 674 0.0 1
(GR581417) CBZZ1324.g1 CBZZ Dictyostelium purpureum 18 hr st... 674 0.0 1
(GR578040) CBXW998.b1 CBXW Dictyostelium purpureum 6 hr vege... 674 0.0 1
(GR578018) CBXW982.b1 CBXW Dictyostelium purpureum 6 hr vege... 674 0.0 1
(GR577218) CBXW2274.b1 CBXW Dictyostelium purpureum 6 hr veg... 674 0.0 1
(GR572753) CBTG955.b1 CBTG Dictyostelium purpureum 12 hr veg... 674 0.0 1
(GR572156) CBTG532.b1 CBTG Dictyostelium purpureum 12 hr veg... 674 0.0 1
(GR571234) CBTG1790.b1 CBTG Dictyostelium purpureum 12 hr ve... 674 0.0 1
(GR587199) CCAB2373.b1 CCAB Dictyostelium purpureum 0 hr sta... 666 0.0 1
(GR572081) CBTG482.b1 CBTG Dictyostelium purpureum 12 hr veg... 666 0.0 1
(GR581133) CBZZ1079.b1 CBZZ Dictyostelium purpureum 18 hr st... 597 0.0 2
(GR578019) CBXW982.g1 CBXW Dictyostelium purpureum 6 hr vege... 634 0.0 2
(GR587200) CCAB2373.g1 CCAB Dictyostelium purpureum 0 hr sta... 595 0.0 2
(GR576209) CBXW1474.g1 CBXW Dictyostelium purpureum 6 hr veg... 642 e-180 1
(GR576208) CBXW1474.b1 CBXW Dictyostelium purpureum 6 hr veg... 642 e-180 1
(AU036940) Dictyostelium discoideum slug cDNA, clone SSB846. 626 e-175 1
(GR581639) CBZZ1516.g1 CBZZ Dictyostelium purpureum 18 hr st... 620 e-173 1
(C94245) Dictyostelium discoideum slug cDNA, clone SSK588. 605 e-168 1
(GR571235) CBTG1790.g1 CBTG Dictyostelium purpureum 12 hr ve... 523 e-149 2
(GR582709) CBZZ891.g1 CBZZ Dictyostelium purpureum 18 hr sta... 513 e-141 1
(GR582708) CBZZ891.b1 CBZZ Dictyostelium purpureum 18 hr sta... 513 e-141 1
(GR586670) CCAB2034.g1 CCAB Dictyostelium purpureum 0 hr sta... 478 e-130 1
(AU074549) Dictyostelium discoideum slug cDNA, clone SSL247. 476 e-130 1
(AU073052) Dictyostelium discoideum slug cDNA, clone SSF804. 476 e-130 1
(GR577517) CBXW581.g1 CBXW Dictyostelium purpureum 6 hr vege... 450 e-122 1
(AU071432) Dictyostelium discoideum slug cDNA, clone SSB488. 349 e-115 2
(AU071766) Dictyostelium discoideum slug cDNA, clone SSC480. 422 e-114 1
(AU073408) Dictyostelium discoideum slug cDNA, clone SSH127. 404 e-108 1
(AU265332) Dictyostelium discoideum vegetative cDNA clone:VS... 381 e-101 1
(GR586669) CCAB2034.b1 CCAB Dictyostelium purpureum 0 hr sta... 373 7e-99 1
(GR570850) CBTG1504.g1 CBTG Dictyostelium purpureum 12 hr ve... 192 5e-94 4
(GR583605) CCAA1771.g1 CCAA Dictyostelium purpureum 0 hr sta... 329 1e-85 1
(AU073409) Dictyostelium discoideum slug cDNA, clone SSH129. 327 4e-85 1
(AU038828) Dictyostelium discoideum slug cDNA, clone SSL533. 289 8e-74 1
(AU072604) Dictyostelium discoideum slug cDNA, clone SSA374. 204 1e-70 2
(GW411697) Ps_Lib1E_29BC12_PSC00271 Unstressed mixed stage P... 254 3e-70 2
(GW411661) Ps_Lib1E_28DF12_PSC00271 Unstressed mixed stage P... 246 8e-68 2
(EH011716) USDA-FP_182069 Lysiphlebus testaceipes adult whol... 250 8e-65 2
(GO301732) AHPZ444.fwd AHPZ Teleopsis dalmanni Late larval e... 256 1e-63 1
(C91381) Dictyostelium discoideum slug cDNA, clone SSK147. 248 3e-61 1
(GO302542) AHSA591.fwd AHSA Teleopsis dalmanni Late larval e... 248 3e-61 1
(GO300731) AGSC469.fwd AGSC Teleopsis dalmanni Late larval e... 248 3e-61 1
(GO297784) CAZC598.fwd CAZC Teleopsis dalmanni Mid-pupal eye... 248 3e-61 1
(GO291586) CAXN9327.fwd CAXN Teleopsis dalmanni Late larval ... 248 3e-61 1
(GO286875) CAXN6157.fwd CAXN Teleopsis dalmanni Late larval ... 248 3e-61 1
(GO285097) CAXN4875.fwd CAXN Teleopsis dalmanni Late larval ... 248 3e-61 1
(GO284396) CAXN445.fwd CAXN Teleopsis dalmanni Late larval e... 248 3e-61 1
(GO281067) CAXN1826.fwd CAXN Teleopsis dalmanni Late larval ... 248 3e-61 1
(GO278667) CZAC3015.fwd CZAC Teleopsis dalmanni Late larval ... 248 3e-61 1
(GO273192) AOTC446.fwd AOTC Teleopsis dalmanni Mid-pupal eye... 248 3e-61 1
(GO273191) AOTC446.rev AOTC Teleopsis dalmanni Mid-pupal eye... 248 3e-61 1
(BW642834) Dugesia ryukyuensis mRNA, clone: Dr_sW_025_J11, 5... 212 4e-61 3
(BW638945) Dugesia ryukyuensis mRNA, clone: Dr_sW_013_D03, 5... 212 5e-61 3
(BW637583) Dugesia ryukyuensis mRNA, clone: Dr_sW_008_O20, 5... 212 6e-61 3
(BW642762) Dugesia ryukyuensis mRNA, clone: Dr_sW_025_F14, 5... 212 6e-61 3
(BX550028) Glossina morsitans morsitans (Tseatse fly) EST fr... 232 8e-61 2
(EZ422443) TSA: Glossina morsitans morsitans GM-1524 mRNA se... 232 8e-61 2
(DV606399) EST1209395 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DN298508) PL04013A1C05 cDNA from sexually mature hermaphodi... 111 1e-60 5
(DV615585) EST1218581 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV615666) EST1218662 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV607273) EST1210269 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV620517) EST1223513 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV607274) EST1210270 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV606400) EST1209396 Glossina morsitans morsitans Fat body ... 232 1e-60 2
(DV618603) EST1221599 Glossina morsitans morsitans Fat body ... 232 2e-60 2
(DN300540) PL04019B1F11 cDNA from sexually mature hermaphodi... 111 2e-60 5
(CJ843861) Triticum aestivum cDNA clone:whatlal33f12, 3' end. 141 6e-60 3
(GO302785) AHSA753.fwd AHSA Teleopsis dalmanni Late larval e... 242 2e-59 1
(GW059539) CCZB13849.g1 CCZB Tetranychus urticae London adul... 194 3e-59 3
(GW059538) CCZB13849.b1 CCZB Tetranychus urticae London adul... 194 3e-59 3
(GT991605) CCIN5512.b1 CCIN Tetranychus urticae London embry... 194 3e-59 3
(EZ048845) TSA: Stomoxys calcitrans SC-4-24-3 ADP ribosylati... 240 7e-59 1
(DN952727) G11-SC-P1 Adult salivary gland cDNA library XWJRA... 240 7e-59 1
(GO299448) AFUY722.fwd AFUY Teleopsis dalmanni Late larval e... 240 7e-59 1
(GO298952) AFUY422.fwd AFUY Teleopsis dalmanni Late larval e... 240 7e-59 1
(GO298873) AFUX758.fwd AFUX Teleopsis dalmanni Late larval e... 240 7e-59 1
(GO291585) CAXN9327.rev CAXN Teleopsis dalmanni Late larval ... 240 7e-59 1
(GO287196) CAXN6353.fwd CAXN Teleopsis dalmanni Late larval ... 240 7e-59 1
(GO282157) CAXN2962.fwd CAXN Teleopsis dalmanni Late larval ... 240 7e-59 1
(DN307775) PL05014B2F03 cDNA from sexually mature hermaphodi... 103 3e-58 5
(CK150930) CsmgEST02373 Culicoides sonorensis female serum-f... 204 4e-58 3
(FM992690) Candida dubliniensis CD36 chromosome 3, complete ... 220 1e-57 2
(GO291533) CAXN9287.fwd CAXN Teleopsis dalmanni Late larval ... 232 2e-56 1
(DC440003) Gryllus bimaculatus mRNA, clone:GB00364-17_H04, 5... 129 3e-56 6
(GW406409) Ps_Lib1E_33DF01_PSC00271 Unstressed mixed stage P... 230 7e-56 1
(FS598746) Polypedilum vanderplanki mRNA, clone: E_ET_PVD00_... 230 7e-56 1
(FD460539) LARVF92TR Haematobia irritans 1st Instar Larvae H... 228 9e-56 2
(FD465075) LARW949TR Haematobia irritans 1st Instar Larvae H... 228 9e-56 2
(FD459366) LARV863TR Haematobia irritans 1st Instar Larvae H... 228 1e-55 2
(FD458379) LARV264TR Haematobia irritans 1st Instar Larvae H... 228 1e-55 2
(FD452293) EGGAG63TR Haematobia irritans eggs Haematobia irr... 228 1e-55 2
(FD459378) LARV869TR Haematobia irritans 1st Instar Larvae H... 228 1e-55 2
(FD465282) LARWA74TR Haematobia irritans 1st Instar Larvae H... 228 1e-55 2
(GR572082) CBTG482.g1 CBTG Dictyostelium purpureum 12 hr veg... 228 3e-55 1
(CJ831062) Triticum aestivum cDNA clone:whatlal33f12, 5' end. 123 7e-55 3
(DY451812) PCAA-aaa135l01.g2 UCI-12 Podocoryna carnea cDNA 5... 206 9e-55 2
(FD465281) LARWA74TF Haematobia irritans 1st Instar Larvae H... 224 1e-54 2
(FD465074) LARW949TF Haematobia irritans 1st Instar Larvae H... 224 1e-54 2
(DT606887) ACAG-aaa50g10.g1 Hydra_EST_UCI-9 Hydra magnipapil... 163 1e-54 3
(FD453064) EGGAL42TF Haematobia irritans eggs Haematobia irr... 224 1e-54 2
(CV464508) taj21d05.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 163 1e-54 3
(FD459377) LARV869TF Haematobia irritans 1st Instar Larvae H... 224 1e-54 2
(FD460538) LARVF92TF Haematobia irritans 1st Instar Larvae H... 224 1e-54 2
(FD458378) LARV264TF Haematobia irritans 1st Instar Larvae H... 224 2e-54 2
(DT612626) ACAG-aaa97h07.g1 Hydra_EST_UCI-9 Hydra magnipapil... 163 2e-54 3
(FC820205) Sr_pAMT7_017a11_T7 S. ratti mixed stage pAMP Stro... 210 3e-54 2
(CD524199) ku97c01.y1 Strongyloides ratti PA female naive pA... 210 3e-54 2
(FC816501) Sr_pAMT7_06e20_T7 S. ratti mixed stage pAMP Stron... 210 3e-54 2
(AI187662) EST485 Manduca sexta male antennae Uni-ZAP XR lib... 224 4e-54 1
(GR921272) MS-GN-384-10-libF_I06 Msex gut Manduca sexta cDNA... 224 4e-54 1
(GR921271) MS-GN-384-10-libF_E16 Msex gut Manduca sexta cDNA... 224 4e-54 1
(GR921270) MS-GN-384-13-libF_L20 Msex gut Manduca sexta cDNA... 224 4e-54 1
(FG291893) 1108800220004 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG291673) 1108793353880 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG291100) 1108793330678 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG290892) 1108793327645 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG289371) 1108793297195 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG289340) 1108793297160 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG288290) 1108793266197 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG287347) 1108770738530 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG287324) 1108770738505 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG286276) 1108770714432 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG286121) 1108770713666 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG285238) 1108770695676 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG284488) 1108770671668 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(FG283642) 1108770632302 New World Screwworm Egg 9261 ESTs C... 224 4e-54 1
(BW636443) Dugesia ryukyuensis mRNA, clone: Dr_sW_005_H12, 5... 170 5e-54 4
(BW640962) Dugesia ryukyuensis mRNA, clone: Dr_sW_019_N13, 5... 170 5e-54 4
(BW640771) Dugesia ryukyuensis mRNA, clone: Dr_sW_019_E07, 5... 170 9e-54 4
(GW049280) CCZB792.b1 CCZB Tetranychus urticae London adult ... 135 1e-53 4
(GW049281) CCZB792.g1 CCZB Tetranychus urticae London adult ... 135 1e-53 4
(BI073736) kt34c04.y1 Strongyloides ratti L2 pAMP1 v1 Chiape... 210 4e-53 2
(CB283646) DF0219 Dermatophagoides farinae cDNA library Derm... 206 5e-53 2
(EZ116557) TSA: Rhagoletis pomonella contig00338, mRNA seque... 220 6e-53 2
(FG295745) 1108770740018 New World Screwworm Larvae 9387 EST... 220 6e-53 1
(FG288120) 1108793259895 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG285903) 1108770707856 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG285294) 1108770695739 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG284528) 1108770671712 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG284234) 1108770658480 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG282817) 1108383360835 New World Screwworm Egg 9261 ESTs C... 220 6e-53 1
(FG080426) UI-FF-IH0-aau-b-02-0-UI.r1 Ceratitis capitata adu... 220 6e-53 1
(FG076408) UI-FF-IF0-abo-d-13-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG076241) UI-FF-IF0-abo-e-09-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG074337) UI-FF-IF0-abi-m-20-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG072720) UI-FF-IF0-aam-h-20-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG070153) UI-FF-IF0-aae-m-20-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG069730) UI-FF-IF0-aad-n-08-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG069021) UI-FF-IF0-aab-p-14-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(FG068377) UI-FF-IF0-aaa-m-17-0-UI.r1 Ceratitis capitata emb... 220 6e-53 1
(DN293455) PL030014A10E02 cDNA from sexually mature hermapho... 111 2e-52 4
(FK192313) XABT206128.b1 Gateway compatible cien cDNA librar... 101 2e-52 5
(CV863623) ACAB-aaa08d02.g1 Hydra UCI6- barcoded EST's Hydra... 163 2e-52 3
(FN208678) Campodea fragilis EST, 5'-end sequence, clone dmp... 131 3e-52 4
(FD454688) EGGAW58TR Haematobia irritans eggs Haematobia irr... 123 3e-52 2
(FF777480) XABT77896.fwd Gateway compatible cien cDNA librar... 101 3e-52 5
(DY449300) HSAA-aaa11h11.g1 UCI-11 Hydra vulgaris cDNA 5' si... 159 3e-52 3
(DR434663) ACAB-aaa16f10.g1 Hydra UCI6- barcoded EST's Hydra... 163 3e-52 3
(FK140181) XABT173977.b1 Gateway compatible cien cDNA librar... 101 3e-52 5
(CV464243) taj37h07.y1 Hydra EST UCI 5 ALP Hydra magnipapill... 163 3e-52 3
(DN814163) ACAC-aab70c04.g1 Hydra EST UCI 7 Hydra magnipapil... 163 3e-52 3
(CV659772) tak18c03.y1 Hydra EST UCI 6 Hydra magnipapillata ... 163 3e-52 3
(FD452292) EGGAG63TF Haematobia irritans eggs Haematobia irr... 216 4e-52 2
(CV863436) ACAB-aaa13b02.g1 Hydra UCI6- barcoded EST's Hydra... 163 4e-52 3
(CX055372) tai89c06.y2 Hydra EST UCI 5 ALP Hydra magnipapill... 161 1e-51 3
(BW642294) Dugesia ryukyuensis mRNA, clone: Dr_sW_023_O06, 5... 178 2e-51 3
(EB594473) AGENCOURT_51488026 D. ananassae EST Drosophila an... 214 4e-51 1
(EB593492) AGENCOURT_51934272 D. ananassae EST Drosophila an... 214 4e-51 1
(EB592957) AGENCOURT_51895064 D. ananassae EST Drosophila an... 214 4e-51 1
(EB592844) AGENCOURT_51886458 D. ananassae EST Drosophila an... 214 4e-51 1
(EB589397) AGENCOURT_51785956 D. ananassae EST Drosophila an... 214 4e-51 1
(EB586958) AGENCOURT_51779329 D. ananassae EST Drosophila an... 214 4e-51 1
(EB586641) AGENCOURT_51795137 D. ananassae EST Drosophila an... 214 4e-51 1
(EB585960) AGENCOURT_51878785 D. ananassae EST Drosophila an... 214 4e-51 1
(EB582903) AGENCOURT_51387751 D. ananassae EST Drosophila an... 214 4e-51 1
(EB581625) AGENCOURT_51781957 D. ananassae EST Drosophila an... 214 4e-51 1
(EB579935) AGENCOURT_51773368 D. ananassae EST Drosophila an... 214 4e-51 1
(EB579592) AGENCOURT_51501963 D. ananassae EST Drosophila an... 214 4e-51 1
(EB579486) AGENCOURT_51403330 D. ananassae EST Drosophila an... 214 4e-51 1
(EB579320) AGENCOURT_51885203 D. ananassae EST Drosophila an... 214 4e-51 1
(EB578482) AGENCOURT_51895190 D. ananassae EST Drosophila an... 214 4e-51 1
(EB577709) AGENCOURT_51885283 D. ananassae EST Drosophila an... 214 4e-51 1
(EB577145) AGENCOURT_51773314 D. ananassae EST Drosophila an... 214 4e-51 1
(EB576917) AGENCOURT_51387789 D. ananassae EST Drosophila an... 214 4e-51 1
(CI999717) Drosophila ananassae cDNA, clone: SAM02.CL.3.cl.3... 214 4e-51 1
(GR581890) CBZZ1725.g1 CBZZ Dictyostelium purpureum 18 hr st... 167 4e-51 2
(CN472522) USDA-FP_121610 Diaprepes abbreviatus, Diaprepes r... 194 4e-51 3
(DT615476) ACAH-aaa83c09.g1 Hydra_EST_UCI-10 Hydra magnipapi... 163 5e-51 3
(BW635147) Dugesia ryukyuensis mRNA, clone: Dr_sW_001_H14, 5... 178 5e-51 3
(FD453065) EGGAL42TR Haematobia irritans eggs Haematobia irr... 212 5e-51 2
(BW643467) Dugesia ryukyuensis mRNA, clone: Dr_sW_027_H07, 5... 178 6e-51 3
(FS595423) Polypedilum vanderplanki mRNA, clone: E_ET_PVD00_... 208 1e-50 2
(AR551031) Sequence 6162 from patent US 6747137. 212 2e-50 1
(FG084922) CMRC-FF-IH0-aby-l-06-0-CMRC.r1 Ceratitis capitata... 212 2e-50 1
(FG077178) UI-FF-IF0-abq-n-08-0-UI.r1 Ceratitis capitata emb... 212 2e-50 1
(FG076615) UI-FF-IF0-abp-i-15-0-UI.r1 Ceratitis capitata emb... 212 2e-50 1
(FG069931) UI-FF-IF0-aaf-c-10-0-UI.r1 Ceratitis capitata emb... 212 2e-50 1
(FG069712) UI-FF-IF0-aad-j-20-0-UI.r1 Ceratitis capitata emb... 212 2e-50 1
(FG068856) UI-FF-IF0-aab-b-19-0-UI.r1 Ceratitis capitata emb... 212 2e-50 1
(DN248790) ACAE-aaa39k14.g1 Hydra EST UCI 5 Hydra magnipapil... 129 2e-50 4
(FG077596) UI-FF-IF0-abs-m-23-0-UI.r1 Ceratitis capitata emb... 210 6e-50 1
(CD525279) kw14d01.y1 Strongyloides ratti PA female naive pA... 194 2e-49 2
(EB589808) AGENCOURT_51352895 D. ananassae EST Drosophila an... 208 2e-49 1
(AB001051) Dugesia japonica mRNA for ADP-ribosylation factor... 170 3e-49 4
(BG225964) kp44b08.y1 TBN95TM-SSFH Strongyloides stercoralis... 174 5e-49 3
(DC445442) Gryllus bimaculatus mRNA, clone:GBpAP002_O07, uns... 129 6e-49 5
(DC864380) Samia cynthia ricini cDNA, clone: I09A02NGRL0006_... 206 7e-49 2
(DC875826) Samia cynthia ricini cDNA, clone: S06A01NCLL0012_... 206 1e-48 1
(DC861205) Samia cynthia ricini cDNA, clone: S13A01NGRL0009_... 206 1e-48 1
(CB284818) DF1631 Dermatophagoides farinae cDNA library Derm... 206 1e-48 1
(FG070286) UI-FF-IF0-aae-h-12-0-UI.r1 Ceratitis capitata emb... 206 1e-48 1
(BY998348) Gryllus bimaculatus mRNA, clone:GBKO108_E10, 5'-e... 129 2e-48 5
(EL603517) He_pwd_0199B09_M13R Heliconius erato pooled wing ... 190 3e-48 2
(DT663760) He_wd2a1_66A04_M13R Heliconius erato wing disk 2 ... 190 3e-48 2
(CR382137) Debaryomyces hansenii strain CBS767 chromosome E ... 117 4e-48 2
(FG075927) UI-FF-IF0-abm-n-08-0-UI.r1 Ceratitis capitata emb... 204 4e-48 1
(CV151769) tai71a06.y2 Hydra EST UCI 5 ALP Hydra magnipapill... 163 4e-48 3
(DQ222228) Daucus carota ADP ribosylation factor 002 (adprf-... 180 4e-48 2
(FG287540) 1108770740854 New World Screwworm Egg 9261 ESTs C... 145 4e-48 2
(CK740231) USDA-FP_6726 Ridge pineapple sweet orange entire ... 172 4e-48 3
(GR577076) CBXW2162.g3 CBXW Dictyostelium purpureum 6 hr veg... 131 4e-48 3
(GR577075) CBXW2162.b1 CBXW Dictyostelium purpureum 6 hr veg... 131 4e-48 3
(FC877582) C31603E05EF HSVdMacro1 Citrus macrophylla cDNA cl... 172 4e-48 3
(CV715589) UCRCS08_0005P18_f Parent Washington Navel Orange ... 172 5e-48 3
(CX051765) UCRCS09_41H07_g Ruby Orange Developing Seed cDNA ... 172 6e-48 3
(CX051773) UCRCS09_41H11_g Ruby Orange Developing Seed cDNA ... 172 6e-48 3
(EY754119) CS12-C1-001-010-H10-CT.F Sweet orange leaf, field... 172 6e-48 3
(DY306609) KN0AAL2DB02FM1 KCl-Salt1 Citrus reshni cDNA 5', m... 172 6e-48 3
(CX051766) UCRCS09_41H07_b Ruby Orange Developing Seed cDNA ... 172 7e-48 3
(CX663268) UCRCP01_002_D01_T7 Swingle citrumelo nematode-cha... 172 7e-48 3
(FC918309) KN0AAL2DB02FM1 KCl_Salt1 Citrus reshni cDNA clone... 172 7e-48 3
(CX051774) UCRCS09_41H11_b Ruby Orange Developing Seed cDNA ... 172 7e-48 3
(EY753458) CS12-C1-001-003-A07-CT.F Sweet orange leaf, field... 172 7e-48 3
(EY754350) CS12-C1-001-013-F03-CT.F Sweet orange leaf, field... 172 8e-48 3
(EY754349) CS12-C1-001-013-F02-CT.F Sweet orange leaf, field... 172 8e-48 3
(EY886442) LT33-C1-003-107-B04-CT.F Tahiti lime leaf, greenh... 172 8e-48 3
(EY704347) CS00-C3-701-031-H02-CT.F Sweet orange fruit, deve... 172 8e-48 3
(FG086400) CMRC-FF-IH0-acd-f-11-0-CMRC.r1 Ceratitis capitata... 119 1e-47 2
(CO843141) LM_GM5_000731 Locusta migratoria gregarious phase... 109 1e-47 4
(CO832800) LM_GH5_000734 Locusta migratoria gregarious phase... 109 1e-47 4
(FN210608) Campodea fragilis EST, 5'-end sequence, clone dmp... 115 1e-47 4
(GW084886) CACE7322.g1 CACE Glomus intraradices extraradical... 192 1e-47 3
(GW084885) CACE7322.b1 CACE Glomus intraradices extraradical... 192 1e-47 3
(CA302382) taa14c04.y1 Hydra cDNA library Hydra magnipapilla... 163 1e-47 3
(DT609222) ACAG-aab05f08.g1 Hydra_EST_UCI-9 Hydra magnipapil... 163 1e-47 3
(AU263746) Dictyostelium discoideum vegetative cDNA clone:VS... 202 2e-47 1
(DC872876) Samia cynthia ricini cDNA, clone: S06A01NCLL0004_... 202 2e-47 1
(DC871172) Samia cynthia ricini cDNA, clone: I10A02NGRL0007_... 202 2e-47 1
(FN234138) Peripatopsis sedgwicki EST, 5'-end sequence, clon... 141 2e-47 4
(GW117492) CCHU16274.b1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW092568) CCHU1884.b2 CCHU Glomus intraradices germinated s... 184 2e-47 3
(GW116083) CCHU15494.b1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW117493) CCHU16274.g1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW116084) CCHU15494.g1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW122434) CCHU19007.b1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW122435) CCHU19007.g1 CCHU Glomus intraradices germinated ... 184 2e-47 3
(GW105246) CCHU8802.b1 CCHU Glomus intraradices germinated s... 184 2e-47 3
(DR393134) USDA-FP_153066 Adult Alate Aphis gossypii (WHAGA)... 168 2e-47 3
(EY754162) CS12-C1-001-011-D12-CT.F Sweet orange leaf, field... 172 3e-47 3
(EL367959) CCES4113.b1_A22.ab1 CCE(LMS) endive Cichorium end... 178 4e-47 2
(FN214470) Endeis spinosa EST, 5'-end sequence, clone dmp041... 163 4e-47 2
(FD454687) EGGAW58TF Haematobia irritans eggs Haematobia irr... 111 6e-47 3
(EY864927) CM30-C1-401-072-D11-CT.F Sweet lime leaf, infecte... 165 1e-46 3
(CJ389140) Molgula tectiformis cDNA, gonad clone:mtgd006m20,... 180 1e-46 3
(CJ328072) Molgula tectiformis cDNA, embryo just before hatc... 180 2e-46 3
(CJ326914) Molgula tectiformis cDNA, embryo just before hatc... 180 2e-46 3
(CJ366930) Molgula tectiformis cDNA, gastrula/neurula clone:... 180 2e-46 3
(EX614690) 255388655 Pea aphid whole body normalized full le... 165 2e-46 2
(EX654095) 256804164 Pea aphid whole body normalized full le... 165 2e-46 2
(FF316192) 280374960 Pea aphid whole body normalized full le... 165 2e-46 2
(EX638776) 256623284 Pea aphid whole body normalized full le... 165 2e-46 2
(EX642621) 256642993 Pea aphid whole body normalized full le... 165 2e-46 2
(FF297614) 279317995 Pea aphid whole body normalized full le... 165 2e-46 2
(FF314661) 279393744 Pea aphid whole body normalized full le... 165 2e-46 2
(CN585342) USDA-FP_128413 Acyrthosiphon pisum, Pea Aphid Acy... 165 2e-46 2
(CN585859) USDA-FP_128930 Acyrthosiphon pisum, Pea Aphid Acy... 165 2e-46 2
(CJ328605) Molgula tectiformis cDNA, embryo just before hatc... 180 2e-46 3
(CJ394431) Molgula tectiformis cDNA, gonad clone:mtgd022g17,... 180 2e-46 3
(CJ327725) Molgula tectiformis cDNA, embryo just before hatc... 180 2e-46 3
(CJ412796) Molgula tectiformis cDNA, larva clone:mtlv013m01,... 180 3e-46 3
(FK140804) XABT174373.b1 Gateway compatible cien cDNA librar... 100 3e-46 5
(FF764999) XABT69397.fwd Gateway compatible cien cDNA librar... 101 4e-46 5
(EY871917) CL06-C4-500-061-E10-CT.F Rangpur lime root, green... 172 6e-46 3
(FK044519) XABT114139.b1 Gateway compatible cien cDNA librar... 101 6e-46 5
(DT612210) ACAG-aaa87h03.g1 Hydra_EST_UCI-9 Hydra magnipapil... 170 6e-46 2
(DR936854) EST1128393 Aquilegia cDNA library Aquilegia formo... 182 7e-46 2
(EL601274) He_pwd_0125H12_M13R Heliconius erato pooled wing ... 182 7e-46 2
(DT768579) EST1202428 Aquilegia cDNA library Aquilegia formo... 182 8e-46 2
(DR936643) EST1128182 Aquilegia cDNA library Aquilegia formo... 182 8e-46 2
(DR936853) EST1128392 Aquilegia cDNA library Aquilegia formo... 182 8e-46 2
(DT768580) EST1202429 Aquilegia cDNA library Aquilegia formo... 182 9e-46 2
(DR936642) EST1128181 Aquilegia cDNA library Aquilegia formo... 182 9e-46 2
(GE841220) He_AcG_09A06_seq3 Heliconius erato male accessory... 182 9e-46 2
(FC791330) CBGC20910.fwd CBGC Lottia gigantea 15h 18h embryo... 131 1e-45 3
(EY203761) PRAG-aaa72c09.g1 Sand_fly_EST_Normalized Phleboto... 168 1e-45 3
(EY211175) PRAG-aaa21b03.g1 Sand_fly_EST_Normalized Phleboto... 168 1e-45 3
(GT037436) CLS_cLiFproots_22a4_1_n18cLibkit5LD_G09 CLS_cLiFp... 76 1e-45 5
(CX644800) UCRPT02_7D04_b Poncirus trifoliata Roots with Iro... 165 1e-45 3
(CN629889) taf40h04.y1 Hydra EST Darmstadt I Hydra magnipapi... 139 2e-45 3
(CX663267) UCRCP01_002_D01_T3 Swingle citrumelo nematode-cha... 172 2e-45 2
(GW105909) CCHU9130.b1 CCHU Glomus intraradices germinated s... 176 3e-45 3
(EX605003) 255344843 Pea aphid whole body normalized full le... 165 3e-45 2
(EY828607) PT11-C2-300-012-B08-CT.F Poncirus trifoliata bark... 172 3e-45 2
(EY828732) PT11-C2-300-020-B03-CT.F Poncirus trifoliata bark... 172 3e-45 2
(EZ610003) TSA: Sarcophaga crassipalpis HAHN.FLY.10177.C3 mR... 190 4e-45 2
(DC861914) Samia cynthia ricini cDNA, clone: S13A01NGRL0011_... 194 4e-45 1
(GW059665) CCZB13920.b1 CCZB Tetranychus urticae London adul... 194 4e-45 1
(EY817464) PT11-C1-900-082-G09-CT.F Poncirus trifoliata leaf... 165 6e-45 3
(EY828504) PT11-C2-300-016-E08-CT.F Poncirus trifoliata bark... 172 1e-44 2
(EB742820) amfb0702 Antheraea mylitta cDNA library Antheraea... 135 1e-44 2
(EB458019) 1099341542624 12-DrosW-std-1P6Kb Drosophila willi... 192 1e-44 1
(EB457577) 1099341444298 12-DrosW-std-1P6Kb Drosophila willi... 192 1e-44 1
(EB456630) 1099341396454 12-DrosW-std-1P6Kb Drosophila willi... 192 1e-44 1
(EB455994) 1099341379503 12-DrosW-std-1P6Kb Drosophila willi... 192 1e-44 1
(BW637140) Dugesia ryukyuensis mRNA, clone: Dr_sW_007_J07, 5... 178 2e-44 3
(GO528934) Mdwdr7510P21.g1 Apple_EST_Mdwdr Malus x domestica... 176 2e-44 2
(EY866258) CM30-C1-401-089-H07-CT.F Sweet lime leaf, infecte... 165 3e-44 3
(CX288945) C02007C02SK IF1 Citrus clementina cDNA clone C020... 168 3e-44 2
(FN209150) Campodea fragilis EST, 5'-end sequence, clone dmp... 184 4e-44 2
(DN619374) UCRCS11_03N09_r Parent Washington Navel Orange Sc... 168 4e-44 2
(DR908461) USDA-FP_16589 Citrus sinensis phloem Citrus sinen... 168 4e-44 2
(CX301774) C08013E01SK PhyRootSw1 Citrus sinensis cDNA clone... 168 4e-44 2
(DN617852) UCRCS11_01M10_r Parent Washington Navel Orange Sc... 168 4e-44 2
(CX074876) UCRCS08_41B06_g Parent Washington Navel Orange Ca... 168 4e-44 2
(CK936838) CGF1004517_E05 Developing fruit flavedo at 80 DAF... 168 4e-44 2
(FF327190) 280433320 Pea aphid whole body normalized full le... 165 4e-44 2
(CK937922) CGF1004480_C03 Developing fruit albedo at 80 DAFB... 168 5e-44 2
(CV717911) UCRCS08_0009L22_r Parent Washington Navel Orange ... 168 5e-44 2
(CV717910) UCRCS08_0009L22_f Parent Washington Navel Orange ... 168 5e-44 2
(FF301855) 279349035 Pea aphid whole body normalized full le... 165 5e-44 2
(EY728564) CS00-C3-704-005-E09-CT.F Sweet orange fruit, deve... 168 5e-44 2
(CX675669) UCRCS08_63H07_b Parent Washington Navel Orange Ca... 168 5e-44 2
(CK932860) CGF1004350_E10 Developing fruit juice sac at 38 D... 168 5e-44 2
(EY654432) CS00-C1-100-055-D09-CT.F Sweet orange leaf, green... 168 5e-44 2
(EY661778) CS00-C1-101-036-H06-CT.F Sweet orange leaf, infec... 168 5e-44 2
(CJ355843) Molgula tectiformis cDNA, cleaving embryo clone:m... 180 6e-44 3
(EB823469) 1109163 CC04 Plodia interpunctella cDNA clone 571... 190 6e-44 1
(EB635787) AGENCOURT_54977323 D. mojavensis EST Drosophila m... 190 6e-44 1
(EB632094) AGENCOURT_54966926 D. mojavensis EST Drosophila m... 190 6e-44 1
(EB627979) AGENCOURT_54973844 D. mojavensis EST Drosophila m... 190 6e-44 1
(EB617716) AGENCOURT_54728270 D. mojavensis EST Drosophila m... 190 6e-44 1
(EB615306) AGENCOURT_54963406 D. mojavensis EST Drosophila m... 190 6e-44 1
(EB602907) AGENCOURT_54976068 D. mojavensis EST Drosophila m... 190 6e-44 1
(FG203501) Aabr00225 Antheraea assama fifth instar larval br... 190 6e-44 1
(EY749682) CS00-C5-003-078-G04-CT.F Sweet orange flower, gre... 168 6e-44 2
(EY748569) CS00-C5-003-060-A07-CT.F Sweet orange flower, gre... 168 6e-44 2
(CV160646) AGRIOTES2POLYT_E05_1_036 Agriotes lineatus cDNA A... 178 7e-44 3
(CJ366337) Molgula tectiformis cDNA, cleaving embryo clone:m... 180 9e-44 3
(CN555363) tae15g07.x1 Hydra EST Darmstadt I Hydra magnipapi... 163 1e-43 3
(FF698802) XABT108713.fwd Gateway compatible cien cDNA libra... 100 1e-43 5
(BW641763) Dugesia ryukyuensis mRNA, clone: Dr_sW_022_E10, 5... 178 2e-43 2
(DR442185) AR2001G01 A. gomesiana hemocytes library Acanthos... 167 2e-43 2
(DR443136) AR2012H04 A. gomesiana hemocytes library Acanthos... 167 2e-43 2
(DW048808) CLLX1554.b1_C05.ab1 CLL(XYZ) lettuce saligna Lact... 155 2e-43 3
(FC772670) CBBN7211.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 123 2e-43 3
(CN473879) USDA-FP_122967 Diaprepes abbreviatus, Diaprepes r... 131 2e-43 2
(FC806397) CBGC7837.fwd CBGC Lottia gigantea 15h 18h embryos... 123 2e-43 3
(FC716155) CBBG10625.fwd CBBG Lottia gigantea 12,15,18h embr... 123 2e-43 3
(FC797666) CBGC24942.fwd CBGC Lottia gigantea 15h 18h embryo... 123 2e-43 3
(DW049672) CLLX2439.b1_N09.ab1 CLL(XYZ) lettuce saligna Lact... 155 2e-43 3
(DW045099) CLLX11902.b1_L24.ab1 CLL(XYZ) lettuce saligna Lac... 155 2e-43 3
(FC733266) CBBG7772.fwd CBBG Lottia gigantea 12,15,18h embry... 123 2e-43 3
(FC680385) CAXX14123.fwd CAXX Lottia gigantea from male gona... 123 3e-43 3
(FC569865) CAWF8618.fwd CAWF Lottia gigantea from mantle (H)... 123 3e-43 3
(FC733369) CBBG7850.fwd CBBG Lottia gigantea 12,15,18h embry... 123 3e-43 3
(FC771307) CBBN6364.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 123 3e-43 3
(FC684347) CAXX17588.fwd CAXX Lottia gigantea from male gona... 123 3e-43 3
(FC765240) CBBN2350.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 123 3e-43 3
(FC723007) CBBG1503.fwd CBBG Lottia gigantea 12,15,18h embry... 123 3e-43 3
(FC769084) CBBN4831.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 123 3e-43 3
(FC766518) CBBN3186.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 123 3e-43 3
(DW061603) CLLY14037.b1_I06.ab1 CLL(XYZ) lettuce saligna Lac... 155 3e-43 3
(FC692555) CAXX3288.fwd CAXX Lottia gigantea from male gonad... 123 3e-43 3
(DW072371) CLLZ3809.b2_B18.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(DW061545) CLLY13984.b1_P15.ab1 CLL(XYZ) lettuce saligna Lac... 155 3e-43 3
(DW060995) CLLY13477.b1_I09.ab1 CLL(XYZ) lettuce saligna Lac... 155 3e-43 3
(DW067876) CLLY7635.b1_F14.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(DW072758) CLLZ4169.b1_B12.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(DW065122) CLLY4731.b1_F07.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(DW072733) CLLZ4146.b1_D06.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(FC638459) CAXU3225.fwd CAXU Lottia gigantea from female gon... 123 3e-43 3
(DW063433) CLLY3095.b1_M05.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(FC640882) CAXU5075.fwd CAXU Lottia gigantea from female gon... 123 3e-43 3
(DW068140) CLLY7899.b1_E08.ab1 CLL(XYZ) lettuce saligna Lact... 155 3e-43 3
(DW046039) CLLX12780.b1_H03.ab1 CLL(XYZ) lettuce saligna Lac... 155 3e-43 3
(FC750791) CBBI536.fwd CBBI Lottia gigantea 26h,37h,61h Larv... 123 3e-43 3
(CX294034) C05005B02SK FlavRip1 Citrus clementina cDNA clone... 165 5e-43 2
(CN184000) UCRCS04_0004N17_r Ruby Orange Developing Flower c... 165 5e-43 2
(FC927157) KN0AAP7YM11FM1 TF Citrus clementina cDNA clone KN... 165 5e-43 2
(CF507075) USDA-FP_122000-573 Immature Ovaries from field-co... 165 6e-43 2
(DN623752) UCRCA01_03P22_r Bark of Madame Vinous Sweet Orang... 165 6e-43 2
(BQ624303) USDA-FP_01394 Ridge pineapple sweet orange entire... 165 6e-43 2
(FC928029) KN0AAP9YL10FM1 TF Citrus clementina cDNA clone KN... 165 6e-43 2
(CK702263) USDA-FP_5525 Ridge pineapple sweet orange entire ... 165 6e-43 2
(DN618789) UCRCS11_03A16_r Parent Washington Navel Orange Sc... 165 6e-43 2
(CN190552) UCRCS06_0003K13_r Washington Navel Orange Stored ... 165 6e-43 2
(EH212654) USDA-FP_175458 WHMH (pink hibiscus mealybug) Maco... 165 6e-43 2
(CF658504) tac66d05.y1 Hydra EST -IV Hydra magnipapillata cD... 163 6e-43 3
(CF417685) USDA-FP_115000-615 Citrus sinensis: Insect-damage... 165 6e-43 2
(CV717582) UCRCS08_0009D12_r Parent Washington Navel Orange ... 165 6e-43 2
(FC876082) C31305B07EF CTVMacrop1 Citrus macrophylla cDNA cl... 165 7e-43 2
(CV712977) UCRCS08_0002C11_r Parent Washington Navel Orange ... 165 7e-43 2
(FC922540) KN0AAM2CF09RM1 SLH Citrus sinensis cDNA clone KN0... 165 7e-43 2
(CX051648) UCRCS09_41C02_g Ruby Orange Developing Seed cDNA ... 165 7e-43 2
(DB888682) Populus nigra mRNA, clone: PnFL2-078_I03, 5'end. 119 7e-43 3
(EY864998) CM30-C1-401-076-C08-CT.F Sweet lime leaf, infecte... 165 7e-43 2
(DN795413) Volcani_1_05_F02 Volcani01 Citrus reticulata x Ci... 165 7e-43 2
(EY762995) CR05-C1-100-061-B08-CT.F Mandarin leaf, greenhous... 165 7e-43 2
(EY672838) CS00-C1-102-108-H05-CT.F Sweet orange leaf, infec... 165 7e-43 2
(CV887000) UCRCS04_2_026E07_T7 Ruby Orange Developing Flower... 165 7e-43 2
(CV886999) UCRCS04_2_026E07_T3 Ruby Orange Developing Flower... 165 7e-43 2
(CX050051) UCRCS09_30B08_g Ruby Orange Developing Seed cDNA ... 165 7e-43 2
(DT214471) UCRCP01_040_A10_T72 Swingle citrumelo nematode-ch... 165 7e-43 2
(CX050262) UCRCS09_31D05_g Ruby Orange Developing Seed cDNA ... 165 7e-43 2
(CX045505) UCRCS07_2C12_g Parent Washington Navel Orange Thr... 165 7e-43 2
(DC888990) Citrus unshiu mRNA, clone: FBI0968, 5'-end sequen... 165 7e-43 2
(EX447212) Volcani_7_06_C12 Volcani07 Citrus reticulata x Ci... 165 7e-43 2
(CV712976) UCRCS08_0002C11_f Parent Washington Navel Orange ... 165 7e-43 2
(EX447200) Volcani_7_06_B12 Volcani07 Citrus reticulata x Ci... 165 7e-43 2
(EY843795) CA26-C1-002-021-B10-CT.F Sour orange leaf, field ... 165 7e-43 2
(CX663349) UCRCP01_003_D04_T7 Swingle citrumelo nematode-cha... 165 8e-43 2
(EY659285) CS00-C1-101-008-D11-CT.F Sweet orange leaf, infec... 165 8e-43 2
(FC897587) IC0AAA37DB06RM1 IVIA1 Citrus clementina cDNA clon... 165 8e-43 2
(DY274842) IC0AAA37DB06RM1 CitNFL Citrus clementina cDNA 5',... 165 8e-43 2
(CX051649) UCRCS09_41C02_b Ruby Orange Developing Seed cDNA ... 165 8e-43 2
(CX050261) UCRCS09_31D05_b Ruby Orange Developing Seed cDNA ... 165 8e-43 2
(CX050050) UCRCS09_30B08_b Ruby Orange Developing Seed cDNA ... 165 8e-43 2
(CN191129) UCRCS06_0004J24_r Washington Navel Orange Stored ... 165 8e-43 2
(CX663348) UCRCP01_003_D04_T3 Swingle citrumelo nematode-cha... 165 8e-43 2
(CX049075) UCRCS09_25D09_g Ruby Orange Developing Seed cDNA ... 165 8e-43 2
(CX049074) UCRCS09_25D09_b Ruby Orange Developing Seed cDNA ... 165 8e-43 2
(EY884016) LT33-C1-003-089-H12-CT.F Tahiti lime leaf, greenh... 165 8e-43 2
(CX078395) UCRCS08_8G08_g Parent Washington Navel Orange Cal... 165 8e-43 2
(CX078394) UCRCS08_8G08_b Parent Washington Navel Orange Cal... 165 8e-43 2
(EY884869) LT33-C1-003-099-F01-CT.F Tahiti lime leaf, greenh... 165 8e-43 2
(DY305866) KN0AAM2CF09RM1 SLH Citrus sinensis cDNA 5', mRNA ... 165 8e-43 2
(CX670474) UCRCP01_051_A12_T7 Swingle citrumelo nematode-cha... 165 8e-43 2
(CX670473) UCRCP01_051_A12_T3 Swingle citrumelo nematode-cha... 165 8e-43 2
(CX665575) UCRCP01_017_E04_T7 Swingle citrumelo nematode-cha... 165 8e-43 2
(EY748044) CS00-C5-003-052-G08-CT.F Sweet orange flower, gre... 165 8e-43 2
(CX669827) UCRCP01_047_C10_T7 Swingle citrumelo nematode-cha... 165 8e-43 2
(CX671204) UCRCP01_055_F07_T7 Swingle citrumelo nematode-cha... 165 8e-43 2
(EY758465) CR05-C1-100-004-C03-CT.F Mandarin leaf, greenhous... 165 8e-43 2
(EY886704) LT33-C1-003-110-B12-CT.F Tahiti lime leaf, greenh... 165 8e-43 2
(EY809735) CR05-C3-702-096-D09-CT.F Mandarin fruit, developm... 165 8e-43 2
(EY758239) CR05-C1-100-001-G06-CT.F Mandarin leaf, greenhous... 165 8e-43 2
(EY848122) CA26-C1-002-074-H08-CT.F Sour orange leaf, field ... 165 8e-43 2
(EY884126) LT33-C1-003-091-B09-CT.F Tahiti lime leaf, greenh... 165 8e-43 2
(CX671203) UCRCP01_055_F07_T3 Swingle citrumelo nematode-cha... 165 8e-43 2
(CX665574) UCRCP01_017_E04_T3 Swingle citrumelo nematode-cha... 165 8e-43 2
(EY758150) CS13-C1-001-040-G04-CT.F Sweet orange leaf, field... 165 8e-43 2
(CK935662) CGF1004553_A11 Developing fruit 24 DAFB Citrus si... 165 8e-43 2
>(AJ000063) Dictyostelium discoideum mRNA for ADP-ribosylation factor 1.
Length = 745
Score = 1273 bits (642), Expect(2) = 0.0
Identities = 642/642 (100%)
Strand = Plus / Plus
Query: 86 gaacaatgggtctcgcttttggtaaacttttcagccgtttctttggcaaaaaagatatga 145
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62 gaacaatgggtctcgcttttggtaaacttttcagccgtttctttggcaaaaaagatatga 121
Query: 146 gaattttaatggtcggtttagatgctgctggtaaaaccaccattttatacaaacttaaat 205
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122 gaattttaatggtcggtttagatgctgctggtaaaaccaccattttatacaaacttaaat 181
Query: 206 taggtgaaattgttactacaattccaaccattggtttcaatgtcgaaactgtcgaattca 265
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 taggtgaaattgttactacaattccaaccattggtttcaatgtcgaaactgtcgaattca 241
Query: 266 aaaacattaacttcactgtatgggatgttggtggtcaagataaaattcgtccattatgga 325
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 aaaacattaacttcactgtatgggatgttggtggtcaagataaaattcgtccattatgga 301
Query: 326 gacattatttccaaaatactcaaggtcttatctttgttgttgattcaaacgatagagaaa 385
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 gacattatttccaaaatactcaaggtcttatctttgttgttgattcaaacgatagagaaa 361
Query: 386 gaattcaagaagcttgtgatgaactcactaaaatgctcaatgaagatgaattacgtgatg 445
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 362 gaattcaagaagcttgtgatgaactcactaaaatgctcaatgaagatgaattacgtgatg 421
Query: 446 ctgttttattagttttctgtaacaaacaagatcttccaaatgccatgagtgtcgctgaag 505
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 ctgttttattagttttctgtaacaaacaagatcttccaaatgccatgagtgtcgctgaag 481
Query: 506 ttaccgataaattaaatctccactctctccgttcaagaaaatggtacatacagtcaactt 565
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 ttaccgataaattaaatctccactctctccgttcaagaaaatggtacatacagtcaactt 541
Query: 566 gtgccaccagtggtgatggtttatatgaaggtttagactggctctcaaataccttaacaa 625
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 542 gtgccaccagtggtgatggtttatatgaaggtttagactggctctcaaataccttaacaa 601
Query: 626 gctcctcaaaataaatgacgtaggaggtcaatttaatagagtttattagattttttaatt 685
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 602 gctcctcaaaataaatgacgtaggaggtcaatttaatagagtttattagattttttaatt 661
Query: 686 atttaataatctaattaaactactgttgtttaattttgaaat 727
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 atttaataatctaattaaactactgttgtttaattttgaaat 703
Score = 67.9 bits (34), Expect(2) = 0.0
Identities = 34/34 (100%)
Strand = Plus / Plus
Query: 25 cttctttctatttaaataaaacttgtattattat 58
||||||||||||||||||||||||||||||||||
Sbjct: 1 cttctttctatttaaataaaacttgtattattat 34
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 120034097
Number of Hits to DB: 1,144,809,213
Number of extensions: 76101742
Number of successful extensions: 10117697
Number of sequences better than 10.0: 43493
Length of query: 727
Length of database: 115,169,689,543
Length adjustment: 24
Effective length of query: 703
Effective length of database: 112,288,871,215
Effective search space: 78939076464145
Effective search space used: 78939076464145
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home