Homology SLB468 vs DNA
Query= SLB468 (SLB468Q) /CSM/SL/SLB4-C/SLB468Q.Seq.d/
(597 letters)
Database: ddbj_B
98,226,423 sequences; 98,766,808,389 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(AU033810) Dictyostelium discoideum slug cDNA, clone SLB468. 694 0.0 2
(BJ434136) Dictyostelium discoideum cDNA clone:ddv16b02, 3' ... 678 0.0 2
(BJ401064) Dictyostelium discoideum cDNA clone:dds22d02, 3' ... 678 0.0 2
(BJ430454) Dictyostelium discoideum cDNA clone:ddv7f12, 3' e... 678 0.0 2
(BJ430268) Dictyostelium discoideum cDNA clone:ddv6l15, 3' e... 678 0.0 2
(BJ432370) Dictyostelium discoideum cDNA clone:ddv18b14, 3' ... 678 0.0 2
(BJ376439) Dictyostelium discoideum cDNA clone:ddc28c18, 3' ... 678 0.0 2
(BJ376965) Dictyostelium discoideum cDNA clone:ddc30d24, 3' ... 678 0.0 2
(BJ375721) Dictyostelium discoideum cDNA clone:ddc19p17, 3' ... 678 0.0 2
(AU268219) Dictyostelium discoideum vegetative cDNA clone:VS... 674 0.0 2
(AU264190) Dictyostelium discoideum vegetative cDNA clone:VS... 672 0.0 2
(BJ378227) Dictyostelium discoideum cDNA clone:ddc27o24, 3' ... 672 0.0 2
(BJ401169) Dictyostelium discoideum cDNA clone:dds22j10, 3' ... 670 0.0 2
(BJ375499) Dictyostelium discoideum cDNA clone:ddc18n24, 3' ... 678 0.0 2
(BJ428586) Dictyostelium discoideum cDNA clone:ddv12b18, 3' ... 678 0.0 2
(BJ377434) Dictyostelium discoideum cDNA clone:ddc24f14, 3' ... 678 0.0 2
(BJ428405) Dictyostelium discoideum cDNA clone:ddv11f23, 3' ... 678 0.0 2
(BJ431909) Dictyostelium discoideum cDNA clone:ddv17b05, 3' ... 678 0.0 2
(BJ430817) Dictyostelium discoideum cDNA clone:ddv8m22, 3' e... 678 0.0 2
(BJ428994) Dictyostelium discoideum cDNA clone:ddv2b05, 3' e... 678 0.0 2
(BJ402770) Dictyostelium discoideum cDNA clone:dds18a09, 3' ... 678 0.0 2
(BJ401714) Dictyostelium discoideum cDNA clone:dds19m03, 3' ... 678 0.0 2
(BJ429435) Dictyostelium discoideum cDNA clone:ddv3p10, 3' e... 678 0.0 2
(BJ402043) Dictyostelium discoideum cDNA clone:dds20c11, 3' ... 678 0.0 2
(BJ371888) Dictyostelium discoideum cDNA clone:ddc10m05, 3' ... 678 0.0 2
(BJ429351) Dictyostelium discoideum cDNA clone:ddv3o03, 3' e... 678 0.0 2
(BJ374105) Dictyostelium discoideum cDNA clone:ddc6d15, 3' e... 678 0.0 2
(BJ374169) Dictyostelium discoideum cDNA clone:ddc6h19, 3' e... 678 0.0 3
(BJ429416) Dictyostelium discoideum cDNA clone:ddv3l12, 3' e... 678 0.0 2
(BJ401392) Dictyostelium discoideum cDNA clone:dds23h05, 3' ... 678 0.0 2
(BJ375722) Dictyostelium discoideum cDNA clone:ddc19p18, 3' ... 672 0.0 2
(BJ372561) Dictyostelium discoideum cDNA clone:ddc13k06, 3' ... 674 0.0 2
(BJ376537) Dictyostelium discoideum cDNA clone:ddc28n22, 3' ... 640 0.0 2
(BJ444786) Dictyostelium discoideum cDNA clone:ddv57o11, 3' ... 652 0.0 3
(BJ377157) Dictyostelium discoideum cDNA clone:ddc22e19, 3' ... 666 0.0 3
(AU052472) Dictyostelium discoideum slug cDNA, clone SLD382. 599 0.0 2
(BJ428769) Dictyostelium discoideum cDNA clone:ddv1m06, 3' e... 678 0.0 3
(BJ376963) Dictyostelium discoideum cDNA clone:ddc30d21, 3' ... 579 0.0 2
(AU052516) Dictyostelium discoideum slug cDNA, clone SLD454. 543 0.0 2
(AU034345) Dictyostelium discoideum slug cDNA, clone SLC725. 507 0.0 2
(C83967) Dictyostelium discoideum slug cDNA, clone SLK621. 337 0.0 3
(BJ378146) Dictyostelium discoideum cDNA clone:ddc27p11, 3' ... 672 0.0 2
(AU034259) Dictyostelium discoideum slug cDNA, clone SLC337. 484 0.0 3
(BJ377613) Dictyostelium discoideum cDNA clone:ddc25e02, 3' ... 662 0.0 2
(BJ428080) Dictyostelium discoideum cDNA clone:ddv10n16, 3' ... 504 0.0 2
(BJ429136) Dictyostelium discoideum cDNA clone:ddv2p10, 3' e... 466 e-180 2
(BJ373650) Dictyostelium discoideum cDNA clone:ddc4e07, 3' e... 424 e-166 3
(BJ433935) Dictyostelium discoideum cDNA clone:ddv23k10, 3' ... 361 e-164 2
(AU034019) Dictyostelium discoideum slug cDNA, clone SLB812. 309 e-163 2
(AU052366) Dictyostelium discoideum slug cDNA, clone SLD204. 299 e-141 2
(AU034084) Dictyostelium discoideum slug cDNA, clone SLB895. 299 e-134 2
(AU052471) Dictyostelium discoideum slug cDNA, clone SLD380. 287 4e-98 2
(BJ400448) Dictyostelium discoideum cDNA clone:dds13h08, 3' ... 293 4e-75 1
(AU053702) Dictyostelium discoideum slug cDNA, clone SLJ517. 287 2e-73 1
(AU061964) Dictyostelium discoideum slug cDNA, clone SLG789. 212 2e-65 2
(AU053418) Dictyostelium discoideum slug cDNA, clone SLI613. 242 1e-59 1
(BJ436105) Dictyostelium discoideum cDNA clone:ddv30a03, 3' ... 131 2e-55 2
(BJ410823) Dictyostelium discoideum cDNA clone:ddv2b05, 5' e... 226 7e-55 1
(AU268703) Dictyostelium discoideum vegetative cDNA clone:VS... 141 2e-49 2
(BJ410430) Dictyostelium discoideum cDNA clone:ddv12b18, 5' ... 202 1e-47 1
(BJ361828) Dictyostelium discoideum cDNA clone:ddc18n24, 5' ... 198 2e-46 1
(BJ415448) Dictyostelium discoideum cDNA clone:ddv22i17, 5' ... 192 1e-44 1
(AU268218) Dictyostelium discoideum vegetative cDNA clone:VS... 190 4e-44 1
(EC761565) PSE00006516 rw_mgpallid Polysphondylium pallidum ... 88 2e-22 3
(EC762209) PSE00006090 rw_mgpallid Polysphondylium pallidum ... 88 2e-22 3
(EC761050) PSE00006607 rw_mgpallid Polysphondylium pallidum ... 88 4e-18 2
(BJ360524) Dictyostelium discoideum cDNA clone:ddc6d15, 5' e... 92 3e-14 1
(BJ412014) Dictyostelium discoideum cDNA clone:ddv6l15, 5' e... 90 1e-13 1
(BJ410953) Dictyostelium discoideum cDNA clone:ddv2p10, 5' e... 90 1e-13 1
(BJ425902) Dictyostelium discoideum cDNA clone:ddv57o11, 5' ... 88 4e-13 1
(FE259583) CAPH7781.rev CAPH Naegleria gruberi amoeba stage ... 56 2e-11 2
(FE244501) CAPG8234.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE231216) CAPG10290.rev CAPG Naegleria gruberi amoeba stage... 56 3e-11 2
(FE236308) CAPG3825.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE259066) CAPH7488.rev CAPH Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE252750) CAPH4177.rev CAPH Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE257707) CAPH6765.rev CAPH Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE252726) CAPH4166.rev CAPH Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE244427) CAPG8191.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE244137) CAPG8029.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE246874) CAPG9650.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE238646) CAPG4959.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE240690) CAPG5972.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE244271) CAPG8107.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE247108) CAPG9777.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(FE240316) CAPG5793.rev CAPG Naegleria gruberi amoeba stage ... 56 3e-11 2
(AU264189) Dictyostelium discoideum vegetative cDNA clone:VS... 64 6e-06 1
(BJ390327) Dictyostelium discoideum cDNA clone:dds22d02, 5' ... 64 6e-06 1
(CT856259) Oryza sativa Indica Group EST sequence:OSIGCRA128... 46 1e-04 2
(BJ388861) Dictyostelium discoideum cDNA clone:dds16e18, 5' ... 58 4e-04 1
(CP000786) Leptospira biflexa serovar Patoc strain 'Patoc 1 ... 56 0.002 1
(CP000777) Leptospira biflexa serovar Patoc strain 'Patoc 1 ... 56 0.002 1
(EU141618) Aporia crataegi voucher NW149-4 cytosolic malate ... 42 0.004 2
(EK268790) 1095462244345 Global-Ocean-Sampling_GS-31-01-01-1... 54 0.006 1
(BJ412197) Dictyostelium discoideum cDNA clone:ddv7f12, 5' e... 54 0.006 1
(FE242096) CAPG7003.rev CAPG Naegleria gruberi amoeba stage ... 48 0.010 2
(CV204410) EST864120 non-normalized T1 cDNA library Trichomo... 46 0.011 2
(FE254059) CAPH4861.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.013 2
(FE264491) CAZO3905.rev CAZO Naegleria gruberi Flagellate St... 48 0.013 2
(FE253386) CAPH4512.rev CAPH Naegleria gruberi amoeba stage ... 48 0.013 2
(FE258730) CAPH7294.rev CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE254058) CAPH4861.rev CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE256394) CAPH6094.rev CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE233834) CAPG2496.rev CAPG Naegleria gruberi amoeba stage ... 48 0.014 2
(FE256454) CAPH6125.rev CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE257333) CAPH6572.rev CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE240443) CAPG5854.rev CAPG Naegleria gruberi amoeba stage ... 48 0.014 2
(FE241564) CAPG6747.rev CAPG Naegleria gruberi amoeba stage ... 48 0.014 2
(FE251692) CAPH3599.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.014 2
(FE254092) CAPH4879.rev CAPH Naegleria gruberi amoeba stage ... 48 0.015 2
(FE247579) CAPH1191.rev CAPH Naegleria gruberi amoeba stage ... 48 0.016 2
(CV204409) EST864119 non-normalized T1 cDNA library Trichomo... 46 0.016 2
(CV204257) EST863967 non-normalized T1 cDNA library Trichomo... 46 0.016 2
(FE255059) CAPH5380.rev CAPH Naegleria gruberi amoeba stage ... 48 0.017 2
(AF288743) Trichomonas tenax putative cytosolic malate dehyd... 38 0.018 2
(BJ360924) Dictyostelium discoideum cDNA clone:ddc8g18, 5' e... 52 0.024 1
(EC762978) PSE00000291 rw_mgpallid Polysphondylium pallidum ... 36 0.078 2
(BJ411150) Dictyostelium discoideum cDNA clone:ddv3o03, 5' e... 50 0.095 1
(BJ389844) Dictyostelium discoideum cDNA clone:dds20c11, 5' ... 50 0.095 1
(FE265505) CAZO4528.fwd CAZO Naegleria gruberi Flagellate St... 48 0.38 1
(FE265504) CAZO4528.rev CAZO Naegleria gruberi Flagellate St... 48 0.38 1
(FE264772) CAZO4065.fwd CAZO Naegleria gruberi Flagellate St... 48 0.38 1
(FE261195) CAZO1854.fwd CAZO Naegleria gruberi Flagellate St... 48 0.38 1
(FE261194) CAZO1854.rev CAZO Naegleria gruberi Flagellate St... 48 0.38 1
(FE258668) CAPH7264.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE258667) CAPH7264.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE258498) CAPH7179.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE258497) CAPH7179.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE257596) CAPH6708.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE257595) CAPH6708.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE256745) CAPH6268.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE256744) CAPH6268.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE254163) CAPH4913.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE254162) CAPH4913.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE252434) CAPH4012.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE252433) CAPH4012.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE251691) CAPH3599.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE248329) CAPH1620.fwd CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE248328) CAPH1620.rev CAPH Naegleria gruberi amoeba stage ... 48 0.38 1
(FE244428) CAPG8191.fwd CAPG Naegleria gruberi amoeba stage ... 48 0.38 1
(CP000282) Saccharophagus degradans 2-40, complete genome. 48 0.38 1
(U38692) Trichomonas vaginalis cytosolic malate dehydrogenas... 46 1.5 1
(CU929739) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 46 1.5 1
(CV221022) EST880732 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV221021) EST880731 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220934) EST880644 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220933) EST880643 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220868) EST880578 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220867) EST880577 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220777) EST880487 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220776) EST880486 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220753) EST880463 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220752) EST880462 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220725) EST880435 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220724) EST880434 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220711) EST880421 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220710) EST880420 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220595) EST880305 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220594) EST880304 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220352) EST880062 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220351) EST880061 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220302) EST880012 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220301) EST880011 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220045) EST879755 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV220044) EST879754 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219971) EST879681 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219970) EST879680 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219957) EST879667 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219956) EST879666 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219840) EST879550 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219839) EST879549 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219820) EST879530 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219819) EST879529 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219691) EST879401 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219690) EST879400 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219520) EST879230 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219519) EST879229 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219416) EST879126 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219415) EST879125 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219334) EST879044 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219333) EST879043 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219332) EST879042 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219331) EST879041 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219281) EST878991 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219280) EST878990 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219247) EST878957 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219246) EST878956 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219035) EST878745 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219034) EST878744 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219021) EST878731 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV219020) EST878730 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218771) EST878481 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218770) EST878480 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218662) EST878372 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218661) EST878371 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218409) EST878119 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218408) EST878118 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218405) EST878115 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218404) EST878114 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218346) EST878056 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218345) EST878055 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218327) EST878037 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218326) EST878036 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218251) EST877961 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218250) EST877960 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218188) EST877898 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218187) EST877897 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218014) EST877724 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV218013) EST877723 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217979) EST877689 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217978) EST877688 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217962) EST877672 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217961) EST877671 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217896) EST877606 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217895) EST877605 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217745) EST877455 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217744) EST877454 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217682) EST877392 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217565) EST877275 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217564) EST877274 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217432) EST877142 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217415) EST877125 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217414) EST877124 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217330) EST877040 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV217329) EST877039 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216841) EST876551 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216823) EST876533 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216731) EST876441 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216730) EST876440 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216700) EST876410 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216697) EST876407 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216696) EST876406 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216660) EST876370 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216576) EST876286 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216575) EST876285 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216511) EST876221 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216510) EST876220 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216356) EST876066 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216355) EST876065 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216306) EST876016 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216305) EST876015 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216284) EST875994 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV216283) EST875993 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215992) EST875702 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215991) EST875701 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215927) EST875637 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215926) EST875636 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215903) EST875613 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215902) EST875612 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215827) EST875537 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215803) EST875513 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215802) EST875512 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215777) EST875487 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215776) EST875486 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215716) EST875426 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215715) EST875425 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215644) EST875354 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215643) EST875353 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215615) EST875325 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215614) EST875324 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215586) EST875296 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215585) EST875295 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215582) EST875292 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215581) EST875291 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215348) EST875058 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215347) EST875057 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215346) EST875056 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215345) EST875055 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215284) EST874994 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215283) EST874993 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215241) EST874951 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV215240) EST874950 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214974) EST874684 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214973) EST874683 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214790) EST874500 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214789) EST874499 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214769) EST874479 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214768) EST874478 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214424) EST874134 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214423) EST874133 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214419) EST874129 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214410) EST874120 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214409) EST874119 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214276) EST873986 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214275) EST873985 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214176) EST873886 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214175) EST873885 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214140) EST873850 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214139) EST873849 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214037) EST873747 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214036) EST873746 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214014) EST873724 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214013) EST873723 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214003) EST873713 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV214002) EST873712 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213819) EST873529 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213818) EST873528 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213813) EST873523 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213812) EST873522 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213768) EST873478 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213767) EST873477 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213764) EST873474 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213763) EST873473 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213600) EST873310 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213599) EST873309 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213233) EST872943 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213232) EST872942 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213207) EST872917 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213206) EST872916 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213076) EST872786 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV213075) EST872785 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212693) EST872403 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212692) EST872402 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212342) EST872052 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212341) EST872051 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212134) EST871844 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212133) EST871843 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212108) EST871818 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV212107) EST871817 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211956) EST871666 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211955) EST871665 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211931) EST871641 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211930) EST871640 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211886) EST871596 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211885) EST871595 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211845) EST871555 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211844) EST871554 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211741) EST871451 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211412) EST871122 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211411) EST871121 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211360) EST871070 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211359) EST871069 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211299) EST871009 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211298) EST871008 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211205) EST870915 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211204) EST870914 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211026) EST870736 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211025) EST870735 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211014) EST870724 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211013) EST870723 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV211000) EST870710 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210999) EST870709 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210918) EST870628 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210917) EST870627 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210906) EST870616 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210905) EST870615 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210851) EST870561 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210850) EST870560 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210827) EST870537 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210826) EST870536 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210706) EST870416 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210705) EST870415 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210690) EST870400 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210689) EST870399 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210646) EST870356 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210645) EST870355 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210510) EST870220 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210509) EST870219 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210421) EST870131 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210420) EST870130 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV210047) EST869757 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209985) EST869695 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209984) EST869694 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209977) EST869687 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209976) EST869686 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209786) EST869496 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209785) EST869495 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209759) EST869469 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209758) EST869468 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209745) EST869455 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209708) EST869418 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209707) EST869417 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209677) EST869387 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209676) EST869386 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209673) EST869383 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209672) EST869382 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209638) EST869348 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209637) EST869347 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209629) EST869339 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209628) EST869338 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209070) EST868780 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV209069) EST868779 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208952) EST868662 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208951) EST868661 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208913) EST868623 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208912) EST868622 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208864) EST868574 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208863) EST868573 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208836) EST868546 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208835) EST868545 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208832) EST868542 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208831) EST868541 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208775) EST868485 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208774) EST868484 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208758) EST868468 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208757) EST868467 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208734) EST868444 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208733) EST868443 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208715) EST868425 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208714) EST868424 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208593) EST868303 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208592) EST868302 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208583) EST868293 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208582) EST868292 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208581) EST868291 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208545) EST868255 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208544) EST868254 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208473) EST868183 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208472) EST868182 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208201) EST867911 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208200) EST867910 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208160) EST867870 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV208159) EST867869 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207807) EST867517 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207651) EST867361 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207650) EST867360 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207622) EST867332 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207621) EST867331 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207513) EST867223 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207512) EST867222 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207489) EST867199 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207488) EST867198 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207466) EST867176 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207465) EST867175 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207310) EST867020 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207309) EST867019 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207135) EST866845 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207134) EST866844 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207133) EST866843 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207132) EST866842 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207122) EST866832 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV207121) EST866831 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206971) EST866681 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206970) EST866680 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206733) EST866443 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206732) EST866442 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206684) EST866394 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206683) EST866393 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206680) EST866390 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206679) EST866389 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206678) EST866388 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206677) EST866387 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206654) EST866364 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206653) EST866363 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206477) EST866187 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206476) EST866186 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206232) EST865942 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV206231) EST865941 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205789) EST865499 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205788) EST865498 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205782) EST865492 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205781) EST865491 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205656) EST865366 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205655) EST865365 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205604) EST865314 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205603) EST865313 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205573) EST865283 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205572) EST865282 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205536) EST865246 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205535) EST865245 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205433) EST865143 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205432) EST865142 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205374) EST865084 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205373) EST865083 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205372) EST865082 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205371) EST865081 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205350) EST865060 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205349) EST865059 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205266) EST864976 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205265) EST864975 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205106) EST864816 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV205105) EST864815 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204981) EST864691 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204980) EST864690 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204943) EST864653 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204942) EST864652 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204861) EST864571 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204860) EST864570 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204709) EST864419 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204708) EST864418 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204483) EST864193 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204482) EST864192 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204387) EST864097 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204386) EST864096 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204258) EST863968 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204241) EST863951 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204240) EST863950 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204025) EST863735 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV204024) EST863734 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV203814) EST863524 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV203813) EST863523 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV203258) EST862968 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV203256) EST862966 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV202762) EST862472 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV202761) EST862471 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV202760) EST862470 non-normalized T1 cDNA library Trichomo... 46 1.5 1
(CV202632) EST862342 Cot1000 normalized T1 cDNA library Tric... 46 1.5 1
(CV202631) EST862341 Cot1000 normalized T1 cDNA library Tric... 46 1.5 1
(CV202534) EST862244 Cot1000 normalized T1 cDNA library Tric... 46 1.5 1
(CV202533) EST862243 Cot1000 normalized T1 cDNA library Tric... 46 1.5 1
>(AU033810) Dictyostelium discoideum slug cDNA, clone SLB468.
Length = 587
Score = 694 bits (350), Expect(2) = 0.0
Identities = 350/350 (100%)
Strand = Plus / Plus
Query: 11 cgtttctctgccttgactcgtttagatcacaacagaggtttagctcaattagccgataaa 70
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 cgtttctctgccttgactcgtttagatcacaacagaggtttagctcaattagccgataaa 60
Query: 71 actggttcagccgtaactgatattgaaaaattctgcatttggggtaaccactctgccacc 130
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 actggttcagccgtaactgatattgaaaaattctgcatttggggtaaccactctgccacc 120
Query: 131 caatacccagatattaactttggtaccgtcaaaggtaaatcactcgtagataccatcaac 190
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 caatacccagatattaactttggtaccgtcaaaggtaaatcactcgtagataccatcaac 180
Query: 191 gatcaaaaatgggttacagataactttattccaaccgttcaacaaagaggtgccgctatt 250
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gatcaaaaatgggttacagataactttattccaaccgttcaacaaagaggtgccgctatt 240
Query: 251 attgctgcccgtggtttatcatcagctgcctctgctgcttcagctgccatcgatcacatg 310
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 attgctgcccgtggtttatcatcagctgcctctgctgcttcagctgccatcgatcacatg 300
Query: 311 agagattggacctatggtaccaatggtcaatggacctctatggccattta 360
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 agagattggacctatggtaccaatggtcaatggacctctatggccattta 350
Score = 307 bits (155), Expect(2) = 0.0
Identities = 155/155 (100%)
Strand = Plus / Plus
Query: 370 tgaatatggtgccgataaaggtctctacttctctttcccagtcattgtagataacaaagg 429
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 tgaatatggtgccgataaaggtctctacttctctttcccagtcattgtagataacaaagg 419
Query: 430 taaatacgaaatcgttaaaggtcttaaacttgatcaattctctcaagaacgtttcgttgc 489
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 420 taaatacgaaatcgttaaaggtcttaaacttgatcaattctctcaagaacgtttcgttgc 479
Query: 490 tactcgtaaagaattattatcagaaatggatggtg 524
|||||||||||||||||||||||||||||||||||
Sbjct: 480 tactcgtaaagaattattatcagaaatggatggtg 514
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 98226423
Number of Hits to DB: 465,118,998
Number of extensions: 23971099
Number of successful extensions: 1821577
Number of sequences better than 10.0: 582
Length of query: 597
Length of database: 98,766,808,389
Length adjustment: 23
Effective length of query: 574
Effective length of database: 96,507,600,660
Effective search space: 55395362778840
Effective search space used: 55395362778840
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home