Homology FC-BC01 vs DNA

Query= FC-BC01 (FC-BC01Q) /CSM/FC/FC-BC/FC-BC01Q.Seq.d/
         (1088 letters)

Database: ddbj_B
           105,743,758 sequences; 104,622,809,269 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(AF188717) Dictyostelium discoideum alanyl-tRNA synthetase (...   963   0.0    5
(C25775) Dictyostelium discoideum gamete cDNA, clone FC-BC01.     963   0.0    3
(BJ397108) Dictyostelium discoideum cDNA clone:dds45h06, 5' ...   955   0.0    3
(BJ332266) Dictyostelium discoideum cDNA clone:dda38c18, 5' ...   955   0.0    3
(BJ423300) Dictyostelium discoideum cDNA clone:ddv48a22, 5' ...   955   0.0    3
(BJ335055) Dictyostelium discoideum cDNA clone:dda48c21, 5' ...   955   0.0    3
(BJ391666) Dictyostelium discoideum cDNA clone:dds24c19, 5' ...   955   0.0    3
(BJ330331) Dictyostelium discoideum cDNA clone:dda31n02, 5' ...   955   0.0    2
(BJ419982) Dictyostelium discoideum cDNA clone:ddv37h23, 5' ...   955   0.0    2
(BJ331551) Dictyostelium discoideum cDNA clone:dda35i23, 5' ...   936   0.0    3
(BJ396840) Dictyostelium discoideum cDNA clone:dds44l02, 5' ...   946   0.0    2
(BJ357242) Dictyostelium discoideum cDNA clone:dda62k23, 3' ...   543   0.0    2
(C25776) Dictyostelium discoideum gamete cDNA, clone FC-BC01.     543   0.0    2
(AU284810) Dictyostelium discoideum gamete cDNA clone:FC-BL1...   527   0.0    2
(BJ443258) Dictyostelium discoideum cDNA clone:ddv52k08, 3' ...   509   0.0    3
(BJ403335) Dictyostelium discoideum cDNA clone:dds24f21, 3' ...   509   0.0    3
(BJ408864) Dictyostelium discoideum cDNA clone:dds47p04, 3' ...   509   0.0    3
(BJ442064) Dictyostelium discoideum cDNA clone:ddv48a22, 3' ...   509   0.0    3
(BJ406731) Dictyostelium discoideum cDNA clone:dds36c10, 3' ...   502   0.0    3
(BJ348906) Dictyostelium discoideum cDNA clone:dda34b20, 3' ...   509   0.0    2
(BJ407396) Dictyostelium discoideum cDNA clone:dds38m12, 3' ...   505   0.0    2
(BJ355836) Dictyostelium discoideum cDNA clone:dda58j12, 3' ...   509   0.0    2
(BJ438412) Dictyostelium discoideum cDNA clone:ddv37h23, 3' ...   509   0.0    2
(BJ353037) Dictyostelium discoideum cDNA clone:dda48c21, 3' ...   484   0.0    3
(BJ347787) Dictyostelium discoideum cDNA clone:dda31n02, 3' ...   498   0.0    3
(BJ405958) Dictyostelium discoideum cDNA clone:dds33j17, 3' ...   484   0.0    2
(BJ349244) Dictyostelium discoideum cDNA clone:dda35i23, 3' ...   484   0.0    3
(BJ352216) Dictyostelium discoideum cDNA clone:dda46e01, 3' ...   513   0.0    2
(BJ407940) Dictyostelium discoideum cDNA clone:dds44l02, 3' ...   511   0.0    2
(BJ385697) Dictyostelium discoideum cDNA clone:ddc55h22, 3' ...   511   0.0    2
(BJ445128) Dictyostelium discoideum cDNA clone:ddv58d13, 3' ...   504   0.0    2
(BJ406132) Dictyostelium discoideum cDNA clone:dds34c08, 3' ...   504   0.0    2
(BJ408217) Dictyostelium discoideum cDNA clone:dds45h06, 3' ...   486   0.0    3
(BJ441893) Dictyostelium discoideum cDNA clone:ddv48n04, 3' ...   484   0.0    3
(BJ445194) Dictyostelium discoideum cDNA clone:ddv58b19, 3' ...   494   0.0    2
(BJ403135) Dictyostelium discoideum cDNA clone:dds24m04, 3' ...   446   0.0    2
(BJ350047) Dictyostelium discoideum cDNA clone:dda38c18, 3' ...   476   0.0    3
(BJ394213) Dictyostelium discoideum cDNA clone:dds34c08, 5' ...   642   0.0    3
(BJ370892) Dictyostelium discoideum cDNA clone:ddc55h22, 5' ...   632   0.0    3
(BJ394727) Dictyostelium discoideum cDNA clone:dds36c10, 5' ...   585   e-179  3
(BJ391681) Dictyostelium discoideum cDNA clone:dds24f21, 5' ...   583   e-178  3
(BJ426368) Dictyostelium discoideum cDNA clone:ddv58b19, 5' ...   636   e-178  1
(BJ370154) Dictyostelium discoideum cDNA clone:ddc53h04, 5' ...   593   e-176  2
(BJ424420) Dictyostelium discoideum cDNA clone:ddv52k08, 5' ...   571   e-173  3
(BJ391505) Dictyostelium discoideum cDNA clone:dds24m04, 5' ...   561   e-155  1
(BJ441492) Dictyostelium discoideum cDNA clone:ddv46j24, 3' ...   383   e-152  2
(BJ403376) Dictyostelium discoideum cDNA clone:dds24n23, 3' ...   406   e-109  1
(BJ426300) Dictyostelium discoideum cDNA clone:ddv58d13, 5' ...   402   e-107  1
(AM758901) Clytia hemisphaerica EST, 5' end sequence, clone ...   129   1e-38  5
(BJ383459) Dictyostelium discoideum cDNA clone:ddc53h04, 3' ...   143   4e-37  2
(BM952188) rc56d10.y1 Meloidogyne hapla egg pAMP1 v1 Meloido...   109   5e-35  3
(DB741542) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB730908) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB754014) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB737382) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB750171) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB754654) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB735185) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB745180) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(DB732732) Apis mellifera head cDNA, RIKEN full-length enric...   105   9e-34  2
(EE003797) ROE00012109 Rhizopus oryzae Company Rhizopus oryz...   137   4e-33  3
(EE004920) ROE00005214 Rhizopus oryzae Company Rhizopus oryz...   137   5e-33  3
(EJ536019) 1092955259340 Global-Ocean-Sampling_GS-29-01-01-1...   117   1e-32  2
(EF650269) Mydas clavatus alanyl-tRNA synthetase (AATS) gene...   129   6e-32  3
(BJ423140) Dictyostelium discoideum cDNA clone:ddv48n04, 5' ...   151   7e-32  1
(DB751745) Apis mellifera head cDNA, RIKEN full-length enric...   105   2e-31  2
(BI926102) EST545991 tomato flower, buds 0-3 mm Solanum lyco...   131   2e-31  2
(CK248639) EST732276 potato callus cDNA library, normalized ...   131   2e-31  2
(CK243374) EST727011 potato callus cDNA library, normalized ...   131   3e-31  2
(CK249522) EST733159 potato callus cDNA library, normalized ...   131   3e-31  2
(CK243373) EST727010 potato callus cDNA library, normalized ...   131   3e-31  2
(CK247842) EST731479 potato callus cDNA library, normalized ...   131   3e-31  2
(DB730693) Apis mellifera head cDNA, RIKEN full-length enric...   105   6e-31  3
(DB743924) Apis mellifera head cDNA, RIKEN full-length enric...    98   6e-31  3
(EJ550067) 1092959435222 Global-Ocean-Sampling_GS-29-01-01-1...   117   1e-30  2
(DB710460) Solanum lycopersicum cDNA, clone: LEFL2005G03, 5'...   131   2e-29  2
(CX700207) 87044.1 Stolon Solanum tuberosum cDNA clone 87044...   131   6e-29  2
(FF770641) XABT73054.fwd Gateway compatible cien cDNA librar...   100   3e-28  3
(FF763874) XABT68670.fwd Gateway compatible cien cDNA librar...   100   3e-28  3
(FK064919) XABT126844.b1 Gateway compatible cien cDNA librar...   100   3e-28  3
(FF747919) XABT57365.fwd Gateway compatible cien cDNA librar...   103   4e-28  3
(DB718907) Solanum lycopersicum cDNA, clone: LEFL2030F17, 5'...   131   8e-28  2
(DK954596) Adiantum capillus-veneris mRNA, clone: TST39A01NG...    64   1e-27  4
(GE721735) CBUP8994.b1 B.anynana_wing.4-6d_2-10kb Bicyclus a...    74   2e-26  3
(FE414084) CBTU4347.fwd CBTU_Daphnia_pulex_Chosen_One_Librar...    80   6e-26  3
(DB726216) Solanum lycopersicum cDNA, clone: LEFL2051L09, 5'...   131   6e-26  1
(BE434392) EST405470 tomato breaker fruit, TIGR Solanum lyco...   131   6e-26  1
(FK108934) XABT154938.b1 Gateway compatible cien cDNA librar...    96   2e-25  2
(FF754328) XABT61824.fwd Gateway compatible cien cDNA librar...    96   2e-25  2
(DL173609) Methods for Identifying the Target of a Compound ...    74   3e-25  3
(AX489169) Sequence 6469 from Patent WO02053728.                   74   3e-25  3
(FF785176) XABT82941.fwd Gateway compatible cien cDNA librar...    88   8e-25  3
(FF764853) XABT69304.fwd Gateway compatible cien cDNA librar...    88   8e-25  3
(FK096265) XABT146131.b1 Gateway compatible cien cDNA librar...    88   8e-25  3
(FF880130) CBWU20425.b1 Yutaka Satou unpublished cDNA librar...    88   9e-25  3
(FK108377) XABT154603.b1 Gateway compatible cien cDNA librar...    88   9e-25  3
(FF753544) XABT61304.fwd Gateway compatible cien cDNA librar...    88   9e-25  3
(FK066065) XABT127510.b1 Gateway compatible cien cDNA librar...    88   9e-25  3
(FF808848) XABT98988.fwd Gateway compatible cien cDNA librar...    88   1e-24  3
(FK132701) XABT169518.b1 Gateway compatible cien cDNA librar...    88   1e-24  3
(FF804542) XABT95734.fwd Gateway compatible cien cDNA librar...    88   1e-24  3
(FF856506) CBWU5921.b1 Yutaka Satou unpublished cDNA library...    88   1e-24  3
(FF716295) XABT35011.fwd Gateway compatible cien cDNA librar...    88   1e-24  3
(DB581127) Halocynthia roretzi cDNA clone:ma310e14, 5' end.       101   3e-24  2
(DB718441) Solanum lycopersicum cDNA, clone: LEFL2028P24, 5'...   125   4e-24  1
(DY885130) CeleSEQ324 Cunninghamella elegans pBluescript (Ec...    82   1e-23  2
(DY893572) CeleSEQ12947 Cunninghamella elegans pBluescript (...    82   1e-23  2
(EF650292) Laxenecera albicincta alanyl-tRNA synthetase (AAT...   123   2e-23  1
(CT856288) Oryza sativa Indica Group EST sequence:OSIGCRA218...    88   2e-23  2
(BW081340) Ciona intestinalis cDNA, clone:rcieg085a05, 3' en...    88   2e-23  2
(BW217139) Ciona intestinalis cDNA, clone:cieg085a05, 5' end...    88   3e-23  2
(FK069080) XABT129327.b1 Gateway compatible cien cDNA librar...    88   3e-23  2
(FF736228) XABT49480.fwd Gateway compatible cien cDNA librar...    88   7e-23  3
(EF650267) Mitrodetus dentitarsis alanyl-tRNA synthetase (AA...   105   1e-22  2
(FF629942) G825P539RF1.T0 Acorn worm normalized gastrula pEx...    94   2e-22  3
(FF477569) G613P6177RG8.T0 Acorn worm blastula/gastrula pCMV...    94   2e-22  3
(EF650291) Lamyra gulo alanyl-tRNA synthetase (AATS) gene, p...   119   2e-22  1
(EF650289) Cerotainia albipilosa alanyl-tRNA synthetase (AAT...   117   1e-21  1
(DB958360) Glycine max cDNA, clone: GMFL02-09-B13, 5'end.         117   1e-21  1
(FK653723) 454GmaGlobSeed388355 Soybean Seeds Containing Glo...   117   1e-21  1
(DL265432) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS.       80   3e-21  3
(DJ131881) Method for identification of useful proteins deri...    80   3e-21  3
(HA140800) Sequence 2501 from Patent WO2006024892.                 80   3e-21  3
(EF650294) Pilica formidolosa alanyl-tRNA synthetase (AATS) ...   115   4e-21  1
(EF650293) Nusa infumata alanyl-tRNA synthetase (AATS) gene,...   115   4e-21  1
(AR548989) Sequence 4120 from patent US 6747137.                   74   5e-21  2
(CZ285790) cp43c11.f Candida parapsilosis Random Genomic Lib...    64   8e-21  4
(FN026924) Petunia axillaris subsp. axillaris EST, clone drs...   109   4e-20  2
(FN025781) Petunia axillaris subsp. axillaris EST, clone drs...   101   4e-20  3
(M55993) B.mori alanyl-tRNA synthetase mRNA, complete cds.         68   5e-20  3
(BH535766) BOGIL41TR BOGI Brassica oleracea genomic clone BO...   111   6e-20  1
(FI739580) BOT01-90F1TR BOT01 Brassica oleracea genomic clon...   111   6e-20  1
(FG913287) UCRVU08_CCNS8741_b4 Cowpea IT97K-461-4 Mixed Tiss...   111   6e-20  1
(FG808493) UCRVU04_CCNI10479_b1 Cowpea 524B Mixed Tissue and...   111   6e-20  1
(AZ917266) 4911.fd64h15.x1 Saccharomyces bayanus MCYC 623-6C...   100   9e-20  2
(AX831298) Sequence 2018 from Patent WO03072602.                   80   9e-20  3
(AX820268) Sequence 2018 from Patent EP1338608.                    80   9e-20  3
(DL344315) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS.       80   1e-19  3
(DJ210764) Method for identification of useful proteins deri...    80   1e-19  3
(HA291715) Sequence 81384 from Patent WO2006024892.                80   1e-19  3
(FF613444) G825P5173RE7.T0 Acorn worm normalized gastrula pE...    94   1e-19  3
(FC229805) CAGG2744.fwd CAGG Nematostella vectensis Nemve Ea...   109   2e-19  2
(DQ332533) Synthetic construct Saccharomyces cerevisiae clon...    80   2e-19  3
(U18672) Saccharomyces cerevisiae cytoplasmic alanyl-tRNA sy...    80   2e-19  3
(I42578) Sequence 3 from patent US 5629188.                        80   2e-19  3
(EU436027) Icaridion debile voucher su2 alanyl-tRNA syntheta...   109   2e-19  1
(Z75243) S.cerevisiae chromosome XV reading frame ORF YOR335c.     80   3e-19  3
(GD055128) KS13039B03 KS13 Capsicum annuum cDNA, mRNA sequence.    86   6e-19  3
(CO087450) GR__Ea05O17.f GR__Ea Gossypium raimondii cDNA clo...    90   8e-19  3
(EF650306) Lycostommyia albifacies alanyl-tRNA synthetase (A...   100   2e-18  2
(EF650327) Neoitamus cyanurus alanyl-tRNA synthetase (AATS) ...    86   2e-18  2
(EF650319) Holcocephala calva alanyl-tRNA synthetase (AATS) ...    92   2e-18  2
(EU436057) Saltella bezzii voucher su39 alanyl-tRNA syntheta...    72   2e-18  2
(FF429787) G142P60110RG4.T0 Acorn worm juvenile pCMVSport6 l...    94   2e-18  2
(GO603817) NBERO1CH_T3_041_H07_09JUL2006_049 NBERO1CH Nicoti...    88   2e-18  2
(FG158666) AGN_RNC023xk22f1.ab1 AGN_RNC Nicotiana tabacum cD...    88   3e-18  2
(CG821418) SOYAS73TV LargeInsertSoybeanGenLib Glycine max ge...   105   4e-18  1
(AL431245) T7 end of clone BB0AA002G10 of library BB0AA from...    66   5e-18  3
(AR319950) Sequence 2500 from patent US 6562958.                   54   1e-17  4
(AC189427) Brassica rapa subsp. pekinensis clone KBrB065N20,...   103   1e-17  1
(EF650290) Choerades bella alanyl-tRNA synthetase (AATS) gen...   103   1e-17  1
(FD543949) RR2FR22TF RR2(MS) Raphanus raphanistrum subsp. ra...   103   1e-17  1
(Z49821) S.cerevisiae PDR10, MYO2, PDR10, SCD5, MIP1, ALA1, ...    80   2e-17  3
(CJ366476) Molgula tectiformis cDNA, gastrula/neurula clone:...    92   2e-17  2
(EF650270) Afroleptomydas sp. 'Clanwilliam' alanyl-tRNA synt...    92   2e-17  2
(DW492730) GH_RMIRS_093_A08_F Cotton Normalized Library rand...    90   3e-17  2
(CJ392091) Molgula tectiformis cDNA, gonad clone:mtgd018j02,...    92   3e-17  2
(EF650268) Opomydas townsendi alanyl-tRNA synthetase (AATS) ...    92   3e-17  2
(CJ393083) Molgula tectiformis cDNA, gonad clone:mtgd008g13,...    92   3e-17  2
(DW492731) GH_RMIRS_093_A08_R Cotton Normalized Library rand...    90   3e-17  2
(AI726299) BNLGHi5539 Six-day Cotton fiber Gossypium hirsutu...    90   3e-17  2
(DV617176) EST1220172 Glossina morsitans morsitans Fat body ...    50   5e-17  4
(GE729690) CBUH3406.b1 B.anynana_wing.LCPP_2-10kb Bicyclus a...    66   1e-16  2
(EL600367) He_pwd_0136F12_M13R Heliconius erato pooled wing ...    54   1e-16  3
(EX811978) CBNA2681.fwd CBNA Phycomyces blakesleeanus NRRL15...   100   1e-16  2
(EX817996) CBNA5866.fwd CBNA Phycomyces blakesleeanus NRRL15...   100   1e-16  2
(EX847212) CBNC6781.fwd CBNC Phycomyces blakesleeanus NRRL15...   100   1e-16  2
(EX848264) CBNC7310.fwd CBNC Phycomyces blakesleeanus NRRL15...   100   1e-16  2
(DT662487) He_wd2a1_72H06_M13R Heliconius erato wing disk 2 ...    54   1e-16  3
(DT665565) He_wd2a1_52A01_M13R Heliconius erato wing disk 2 ...    54   2e-16  3
(Z22673) A.thaliana tRNA synthetase.                              100   2e-16  1
(BT008807) Arabidopsis thaliana At1g50200 gene, complete cds.     100   2e-16  1
(BT008649) Arabidopsis thaliana clone RAFL09-78-D07 (R19577)...   100   2e-16  1
(BT002526) Arabidopsis thaliana Unknown protein mRNA, comple...   100   2e-16  1
(AK226885) Arabidopsis thaliana mRNA for putative alanine--t...   100   2e-16  1
(AC007980) Arabidopsis thaliana chromosome I BAC F14I3 genom...   100   2e-16  1
(CQ804806) Sequence 1217 from Patent WO2004035798.                100   2e-16  1
(EF650288) Atomosia puella alanyl-tRNA synthetase (AATS) gen...   100   2e-16  1
(EG525580) AYAXO28TF pooled cDNA populations Arabidopsis tha...   100   2e-16  1
(EG485831) AYASN68TR pooled cDNA populations Arabidopsis tha...   100   2e-16  1
(AV529902) Arabidopsis thaliana cDNA clone:APZL51f06R, 5' end.    100   2e-16  1
(AV528274) Arabidopsis thaliana cDNA clone:APZL05b11R, 5' end.    100   2e-16  1
(BP562614) Arabidopsis thaliana cDNA clone:RAFL09-97-M18, 5'...   100   2e-16  1
(EU436059) Saltella sphondylii voucher su41 alanyl-tRNA synt...    62   3e-16  3
(CR382133) Debaryomyces hansenii strain CBS767 chromosome A ...    74   1e-15  3
(CR858480) Pongo abelii mRNA; cDNA DKFZp459G207 (from clone ...    82   3e-15  3
(AM469609) Vitis vinifera contig VV78X203805.6, whole genome...    76   3e-15  3
(EU436058) Saltella nigripes voucher su40 alanyl-tRNA synthe...    96   4e-15  1
(EF650295) Laphystia tolandi alanyl-tRNA synthetase (AATS) g...    96   4e-15  1
(FK924246) EST_lsal_evj_957020 lsalevj mixed_tissue_mixed_st...    96   4e-15  1
(EU436048) Lasionemopoda hirsuta voucher su25 alanyl-tRNA sy...    92   5e-15  2
(EK272688) 1095462264906 Global-Ocean-Sampling_GS-31-01-01-1...    54   6e-15  4
(CN571925) rf35b08.x1 Meloidogyne hapla J2 pAMP1 v1 Meloidog...    94   1e-14  1
(EU436028) Gluma nitida voucher su3 alanyl-tRNA synthetase (...    62   2e-14  3
(DT662478) He_wd2a1_72G04_M13R Heliconius erato wing disk 2 ...    54   3e-14  3
(CV708473) UCRPT01_0011G02_r Poncirus trifoliata CTV-challen...    90   3e-14  2
(GH105045) G993P134RK23.T0 Neurospora crassa cDNA - 1 hour G...    82   3e-14  2
(GE957862) G1176P158RM21.T1 Neurospora crassa cDNA - 1 hour ...    82   3e-14  2
(CR787743) Pongo abelii mRNA; EST DKFZp468I2329_r1 (from clo...    82   3e-14  2
(GH089737) G993P113RE21.T0 Neurospora crassa cDNA - 1 hour G...    82   3e-14  2
(GE948105) G1176P149RH22.T0 Neurospora crassa cDNA - 1 hour ...    82   3e-14  2
(GE957924) G1176P158RM21.T0 Neurospora crassa cDNA - 1 hour ...    82   3e-14  2
(GE944381) G1176P141RF2.T0 Neurospora crassa cDNA - 1 hour O...    82   3e-14  2
(CR629714) Pongo abelii mRNA; EST DKFZp469M0521_r1 (from clo...    82   3e-14  2
(EY681459) CS00-C1-650-022-C03-CT.F Sweet orange leaf, young...    90   3e-14  2
(CD576239) UCRPT01_03de07_g3 Poncirus trifoliata CTV-challen...    90   3e-14  2
(EY764718) CR05-C1-100-063-F02-CT.F Mandarin leaf, greenhous...    90   3e-14  2
(FC892464) IC0AAA21DD03RM1 IVIA1 Citrus clementina cDNA clon...    90   3e-14  2
(EY679970) CS00-C1-650-006-A06-CT.F Sweet orange leaf, young...    90   3e-14  2
(EF207962) Heliconius erato alanyl-tRNA synthetase-like (Aat...    54   3e-14  3
(DV182174) CT001_D11_CT001_3700_91.ab1 C. tentans tissue cul...    64   3e-14  2
(FC906727) IC0AAA1BD12RM1 IVIA1 Citrus clementina cDNA clone...    90   3e-14  2
(EY767503) CR05-C1-102-017-A11-CT.F Mandarin leaf, infected ...    90   3e-14  2
(FC898206) IC0AAA20BF11RM1 IVIA1 Citrus clementina cDNA clon...    90   4e-14  2
(FC880530) IC0AAA37AC07RM1 IVIA1 Citrus clementina cDNA clon...    90   4e-14  2
(DY266596) IC0AAA1BD12RM1 CitNFL Citrus clementina cDNA 5', ...    90   4e-14  2
(DY267065) IC0AAA20BF11RM1 CitNFL Citrus clementina cDNA 5',...    90   5e-14  2
(DY267573) IC0AAA21DD03RM1 CitNFL Citrus clementina cDNA 5',...    90   5e-14  2
(DY274573) IC0AAA37AC07RM1 CitNFL Citrus clementina cDNA 5',...    90   5e-14  2
(AM450310) Vitis vinifera contig VV78X124834.14, whole genom...    72   5e-14  3
(EF650310) Scylaticus costalis alanyl-tRNA synthetase (AATS)...    92   5e-14  1
(CX159373) DV01207.5prime DV Drosophila virilis Embryo Droso...    92   5e-14  1
(CR382126) Kluyveromyces lactis strain NRRL Y-1140 chromosom...    78   7e-14  3
(GH101196) G993P128RL9.T0 Neurospora crassa cDNA - 1 hour Gl...    82   1e-13  2
(FC647276) CAXU8955.fwd CAXU Lottia gigantea from female gon...    88   1e-13  2
(EK041560) 1092959522921 Global-Ocean-Sampling_GS-31-01-01-1...    68   1e-13  2
(GH097135) G993P121RP2.T0 Neurospora crassa cDNA - 1 hour Gl...    82   1e-13  2
(GE540731) CCHS27160.b1_O22.ab1 CCHS Espina Barnadesia spino...    80   1e-13  2
(GH090934) G993P18FI10.T0 Neurospora crassa cDNA - 1 hour Gl...    82   1e-13  2
(AC225511) Medicago truncatula clone mth2-88i1, complete seq...    90   2e-13  1
(FH287845) CHO_OF4201xp07f1.ab1 CHO_OF4 Nicotiana tabacum ge...    90   2e-13  1
(CV712141) UCRPT01_0016P23_r Poncirus trifoliata CTV-challen...    90   2e-13  1
(CV709297) UCRPT01_0012K10_r Poncirus trifoliata CTV-challen...    90   2e-13  1
(CB417303) EST0379 Mature peel (flavedo) cDNA subtraction li...    90   2e-13  1
(BQ869008) QGD4e08.yg.ab1 QG_ABCDI lettuce salinas Lactuca s...    90   2e-13  1
(EY762553) CR05-C1-100-055-G10-CT.F Mandarin leaf, greenhous...    90   2e-13  1
(EY738956) CS00-C3-705-050-C10-CT.F Sweet orange fruit, deve...    90   2e-13  1
(EY656406) CS00-C1-100-119-D02-CT.F Sweet orange leaf, green...    90   2e-13  1
(AV830219) Arabidopsis thaliana cDNA clone:RAFL09-64-P04, 5'...    90   2e-13  1
(FM992693) Candida dubliniensis CD36 chromosome 6, complete ...    74   3e-13  11
(CX178486) E12_45-121_10.ab1 leaf inoculated with Marssonia ...    62   4e-13  3
(CK446639) pncs907aA05.SP6 Aspergillus nidulans negative sub...    78   4e-13  2
(EB609121) AGENCOURT_56953483 D. grimshawi EST Drosophila gr...    86   4e-13  2
(GE922574) G1176P110RF13.T0 Neurospora crassa cDNA - 1 hour ...    82   4e-13  2
(GH088705) G993P110RM16.T0 Neurospora crassa cDNA - 1 hour G...    82   4e-13  2
(DY963514) CLSM13766.b1_L10.ab1 CLS(LMS) lettuce sativa Lact...    82   5e-13  2
(DT501783) WS01314.BR_D07 PTxD-IL-FL-A-4 Populus trichocarpa...    62   6e-13  3
(AV413970) Lotus japonicus cDNA clone:MWM238a07_r, 5' end.         88   9e-13  1
(EX059700) BR044344 salt-treated whole plant cDNA library KB...    88   9e-13  1
(EF650265) Phycus frommeri alanyl-tRNA synthetase (AATS) gen...    74   1e-12  2
(EU410379) Ospriocerus aeacus voucher Asil-370 alanyl-tRNA s...    70   1e-12  2
(CK290840) EST753554 Nicotiana benthamiana mixed tissue cDNA...    68   2e-12  2
(CK289717) EST752439 Nicotiana benthamiana mixed tissue cDNA...    68   2e-12  2
(EU436054) Palaeosepsis pusio voucher su33 alanyl-tRNA synth...    86   3e-12  1
(EF148384) Populus trichocarpa x Populus deltoides clone WS0...    62   4e-12  3
(GO332523) VBL6_39_F23_E001.g1 Normalized cDNA library from ...    74   5e-12  2
(EF650304) Connomyia varipennis alanyl-tRNA synthetase (AATS...    52   5e-12  2
(BQ408844) GA__Ed0012D07r Gossypium arboreum 7-10 dpa fiber ...    82   6e-12  2
(EY769513) CR05-C1-102-002-A04-CT.F Mandarin leaf, infected ...    82   7e-12  2
(DW484034) GH_RMIRS_045_B09_F Cotton Normalized Library rand...    82   7e-12  2
(DW484033) GH_RMIRS_045_B09_077_R Cotton Normalized Library ...    82   8e-12  2
(EF650296) Trichardis sp. TD-2008 alanyl-tRNA synthetase (AA...    84   1e-11  1
(EB556236) AGENCOURT_51203776 D. virilis EST Drosophila viri...    84   1e-11  1
(BP189739) Dugesia japonica cDNA, clone: 02205_HH, expressed...    84   1e-11  1
(GP280038) Sequence 12218 from patent US 7504493.                  80   2e-11  8
(DJ025883) Genome-wide DNA marker of Saccharomyces cerevisiae.     80   2e-11  8
(DX971482) CHORI105-20C11.TV.2 CHORI105.pTARBAC1.3 Trypanoso...    68   2e-11  3
(EC134092) HVE00009680 Hartmannella vermiformis Normalized l...    48   2e-11  3
(AM600114) Paracentrotus lividus EST, clone MPMGp1174G2271Q,...    64   2e-11  2
(GE932098) G1176P120RI8.T0 Neurospora crassa cDNA - 1 hour O...    82   2e-11  2
(FC674836) CAXX10263.fwd CAXX Lottia gigantea from male gona...    80   3e-11  2
(FC819793) Sr_pAMT7_015n20_T7 S. ratti mixed stage pAMP Stro...    74   3e-11  2
(BJ370418) Dictyostelium discoideum cDNA clone:ddc54f05, 5' ...    54   3e-11  3
(EH083343) PMEAO09TR Perkinsus marinus large insert cDNA lib...    58   3e-11  2
(AC206538) Pongo abelii BAC clone CH276-53E8 from chromosome...    82   4e-11  4
(EU436026) Lopa convexa voucher su1 alanyl-tRNA synthetase (...    44   4e-11  4
(EF650284) Molobratia teutonus alanyl-tRNA synthetase (AATS)...    64   5e-11  3
(CU329670) Schizosaccharomyces pombe chromosome I.                 82   5e-11  1
(AC125476) Medicago truncatula clone mth2-10e13, complete se...    82   5e-11  1
(EU436031) Archisepsis excavata voucher su8 alanyl-tRNA synt...    82   5e-11  1
(DW048291) CLLX14895.b1_N04.ab1 CLL(XYZ) lettuce saligna Lac...    82   5e-11  1
(DT573462) EST1084102 GH_TMO Gossypium hirsutum cDNA, mRNA s...    82   5e-11  1
(CR789057) Pongo abelii mRNA; EST DKFZp468F0932_r1 (from clo...    82   5e-11  1
(CR554880) Pongo abelii mRNA; EST DKFZp469K0114_r1 (from clo...    82   5e-11  1
(CR543395) Pongo abelii mRNA; EST DKFZp459G098_r1 (from clon...    82   5e-11  1
(BM358474) GA__Ea0009K01r Gossypium arboreum 7-10 dpa fiber ...    82   5e-11  1
(BM358439) GA__Ea0009E13r Gossypium arboreum 7-10 dpa fiber ...    82   5e-11  1
(GH110681) G993P141RB9.T0 Neurospora crassa cDNA - 1 hour Gl...    82   5e-11  1
(GH110522) G993P141FB9.T0 Neurospora crassa cDNA - 1 hour Gl...    82   5e-11  1
(GH096054) G993P119RM23.T0 Neurospora crassa cDNA - 1 hour G...    82   5e-11  1
(GE945869) G1176P144RB19.T0 Neurospora crassa cDNA - 1 hour ...    82   5e-11  1
(BJ419749) Dictyostelium discoideum cDNA clone:ddv37g05, 5' ...    54   5e-11  3
(BJ418823) Dictyostelium discoideum cDNA clone:ddv34k03, 5' ...    54   5e-11  3
(GE930425) G1176P124RK11.T0 Neurospora crassa cDNA - 1 hour ...    48   5e-11  3
(BJ421875) Dictyostelium discoideum cDNA clone:ddv44j05, 5' ...    54   5e-11  3
(BJ421195) Dictyostelium discoideum cDNA clone:ddv41c04, 5' ...    54   5e-11  3
(BJ338004) Dictyostelium discoideum cDNA clone:dda59b23, 5' ...    54   6e-11  3
(BJ397198) Dictyostelium discoideum cDNA clone:dds45m11, 5' ...    54   6e-11  3
(BJ427228) Dictyostelium discoideum cDNA clone:ddv61a20, 5' ...    54   6e-11  3
(EF650311) Tillobroma punctipennis alanyl-tRNA synthetase (A...    76   7e-11  2
(DV091451) 327-384-43_I16_M13-FP Nematostella vectensis norm...    54   8e-11  2
(EF650318) Damalis monochaetes alanyl-tRNA synthetase (AATS)...    54   8e-11  2
(EK241913) 1095460228545 Global-Ocean-Sampling_GS-31-01-01-1...    46   1e-10  4
(EF650282) Diogmites grossus alanyl-tRNA synthetase (AATS) g...    80   2e-10  1
(FI793939) SIR-19I15TF Sisymbrium irio BAC library SIR Sisym...    80   2e-10  1
(GE545543) CCHS4492.b1_G20.ab1 CCHS Espina Barnadesia spinos...    80   2e-10  1
(EU436053) Ortalischema albitarse voucher su31 alanyl-tRNA s...    70   2e-10  2
(EU436050) Microsepsis armillata voucher su28 alanyl-tRNA sy...    76   3e-10  2
(EF650271) Neolophonotus bimaculatus alanyl-tRNA synthetase ...    72   3e-10  2
(EF650274) Proctacanthus philadelphicus alanyl-tRNA syntheta...    66   3e-10  2
(EL602584) He_pwd_0205G05_M13R Heliconius erato pooled wing ...    54   3e-10  3
(FG521107) 030702KAZB009869HT (KAZB) Actinidia chinensis you...    68   3e-10  2
(AM505060) Paracentrotus lividus EST, clone MPMGp1171P073Q, ...    64   3e-10  2
(AM507962) Paracentrotus lividus EST, clone MPMGp1171B0317Q,...    64   4e-10  2
(AM508849) Paracentrotus lividus EST, clone MPMGp1171K1423Q,...    64   4e-10  2
(AM522221) Paracentrotus lividus EST, clone MPMGp1171I2222Q,...    64   4e-10  2
(EF650283) Lestomyia fraudiger alanyl-tRNA synthetase (AATS)...    52   4e-10  3
(BX842632) Neurospora crassa DNA linkage group I BAC contig ...    74   6e-10  2
(EF650308) Prolepsis tristis alanyl-tRNA synthetase (AATS) g...    50   6e-10  3
(BJ425146) Dictyostelium discoideum cDNA clone:ddv54d22, 5' ...    50   6e-10  3
(EU436032) Archisepsis pleuralis voucher su9 alanyl-tRNA syn...    78   8e-10  1
(DQ048406) Pan troglodytes AARS gene, VIRTUAL TRANSCRIPT, pa...    66   1e-09  3
(BJ562700) Ipomoea nil cDNA clone:jm37l07, 5' end, single read.    60   1e-09  2
(CJ750557) Ipomoea nil cDNA clone:jmsf50b10, 5' end.               60   1e-09  2
(AM514673) Paracentrotus lividus EST, clone MPMGp1171P0719Q,...    62   1e-09  2
(EY847270) CA26-C1-002-067-A04-CT.F Sour orange leaf, field ...    76   2e-09  2
(EK098920) 1092962061505 Global-Ocean-Sampling_GS-31-01-01-1...    72   2e-09  2
(EF650300) Emphysomera pallidapex alanyl-tRNA synthetase (AA...    76   3e-09  1
(CR769524) Pongo abelii mRNA; EST DKFZp469N0829_r1 (from clo...    76   3e-09  1
(CP000941) Xylella fastidiosa M12, complete genome.                76   3e-09  1
(EF650264) Bombylius major alanyl-tRNA synthetase (AATS) gen...    66   4e-09  2
(EU436034) Archisepsis scabra voucher su11 alanyl-tRNA synth...    48   4e-09  2
(DB891525) Populus nigra mRNA, clone: PnFL2-095_P09, 5'end.        62   4e-09  2
(CX174114) G03_69-74_13.ab1 leaf inoculated with Marssonia p...    62   5e-09  2
(DN312686) PL06013B1D12 cDNA from juvenile hermaphodites Sch...    46   6e-09  4
(DU099733) JBnY022G19F Brassica napus BAC library JBnY Brass...    72   6e-09  2
(DU103339) JBnY022G20F Brassica napus BAC library JBnY Brass...    72   6e-09  2
(FE849031) CAFO1831.fwd CAFO Pichia stipitis aerobic xylose ...    58   7e-09  4
(FE844386) CAFH387.fwd CAFH Pichia stipitis aerobic dextrose...    58   7e-09  4
(FE854364) CAFT1076.fwd CAFT Pichia stipitis oxygen limited ...    58   7e-09  4
(FE843683) CAFH1456.fwd CAFH Pichia stipitis aerobic dextros...    58   8e-09  4
(FE854431) CAFT1111.fwd CAFT Pichia stipitis oxygen limited ...    58   8e-09  4
(CP000584) Ostreococcus lucimarinus CCE9901 chromosome 4, co...    74   1e-08  1
(EU436030) Archisepsis diversiformis voucher su7 alanyl-tRNA...    74   1e-08  1
(DW489173) GH_RMIRS_073_F03_R Cotton Normalized Library rand...    74   1e-08  1
(DW489172) GH_RMIRS_073_F03_F Cotton Normalized Library rand...    74   1e-08  1
(DW148198) CLVX13226.b1_D19.ab1 CLV(XYZ) lettuce virosa Lact...    74   1e-08  1
(DW148140) CLVX13172.b1_H05.ab1 CLV(XYZ) lettuce virosa Lact...    74   1e-08  1
(DW085602) CLPX8674.b1_C10.ab1 CLP(XYZ) lettuce perennis Lac...    74   1e-08  1
(DW082334) CLPX5154.b1_D17.ab1 CLP(XYZ) lettuce perennis Lac...    74   1e-08  1
(CD524119) ku96c09.y1 Strongyloides ratti PA female naive pA...    74   1e-08  1
(GH106057) G993P133RL13.T0 Neurospora crassa cDNA - 1 hour G...    74   1e-08  1
(GE938699) G1176P133RP20.T0 Neurospora crassa cDNA - 1 hour ...    74   1e-08  1
(FF329328) 280439790 Pea aphid whole body normalized full le...    74   1e-08  1
(FF320343) 280407743 Pea aphid whole body normalized full le...    74   1e-08  1
(FF317626) 280393364 Pea aphid whole body normalized full le...    74   1e-08  1
(FF312747) 279385561 Pea aphid whole body normalized full le...    74   1e-08  1
(FF295136) 279304728 Pea aphid whole body normalized full le...    74   1e-08  1
(EX649881) 256735934 Pea aphid whole body normalized full le...    74   1e-08  1
(EX648419) 256721676 Pea aphid whole body normalized full le...    74   1e-08  1
(EX639914) 256631207 Pea aphid whole body normalized full le...    74   1e-08  1
(EX637333) 256614881 Pea aphid whole body normalized full le...    74   1e-08  1
(EX626015) 255434375 Pea aphid whole body normalized full le...    74   1e-08  1
(EX622954) 255422642 Pea aphid whole body normalized full le...    74   1e-08  1
(EX612498) 255379665 Pea aphid whole body normalized full le...    74   1e-08  1
(EX610508) 255371893 Pea aphid whole body normalized full le...    74   1e-08  1
(AE003849) Xylella fastidiosa 9a5c, complete genome.               74   1e-08  1
(ES228145) T01172_J07_C1C2_E07_012 CC - Norway Spruce Subtra...    66   1e-08  2
(EU436085) Zuskamira inexpectata voucher su75 alanyl-tRNA sy...    70   1e-08  2
(EF650277) Dysmachus trigonus alanyl-tRNA synthetase (AATS) ...    64   1e-08  2
(EJ078905) 1095458144962 Global-Ocean-Sampling_GS-26-01-01-1...    54   2e-08  2
(CN952301) Ha_mx0_58d02_SP6 Lobster Multiple Tissues, Normal...    72   2e-08  2
(EK314434) 1095462408118 Global-Ocean-Sampling_GS-31-01-01-1...    46   2e-08  3
(FG496481) 030414KAWC007674HT (KAWC) Actinidia chinensis - a...    68   2e-08  2
(CU466930) Candidatus Cloacamonas acidaminovorans provisiona...    58   5e-08  2
(EH116683) HA_MX0_95g05_SP6 Lobster Multiple Tissues, Normal...    72   5e-08  1
(GE484530) CCFS1587.b1_E13.ab1 CCF(STU) sunflower Helianthus...    72   5e-08  1
(BJ558889) Ipomoea nil cDNA clone:jm26p13, 5' end, single read.    54   5e-08  2
(EL506625) B06_PF-SAU3A-T3-M-P25_D.AB1 Blood stage Plasmodiu...    58   5e-08  2
(EL506624) B06_PF-SAU3A-T3-M-P25.AB1 Blood stage Plasmodium ...    58   5e-08  2
(GO725500) 010709OTYA022074HT OTYA Ovis aries cDNA 5', mRNA ...    60   6e-08  2
(DQ048405) Homo sapiens AARS gene, VIRTUAL TRANSCRIPT, parti...    58   6e-08  3
(DQ894824) Synthetic construct Homo sapiens clone IMAGE:1000...    58   6e-08  3
(DQ891634) Synthetic construct clone IMAGE:100004264; FLH178...    58   6e-08  3
(AM521760) Paracentrotus lividus EST, clone MPMGp1171L0911Q,...    56   7e-08  2
(BC011451) Homo sapiens alanyl-tRNA synthetase, mRNA (cDNA c...    58   7e-08  3
(AK299098) Homo sapiens cDNA FLJ61339 complete cds, highly s...    58   7e-08  3
(DT663696) He_wd2a1_95B07_M13R Heliconius erato wing disk 2 ...    54   7e-08  2
(CQ725247) Sequence 11181 from Patent WO02068579.                  58   7e-08  3
(GN089244) Sequence 7 from Patent WO2009032915.                    58   7e-08  3
(GC694681) Sequence 4054 from patent US 6812339.                   58   7e-08  3
(AK222824) Homo sapiens mRNA for alanyl-tRNA synthetase vari...    58   7e-08  3
(AM515276) Paracentrotus lividus EST, clone MPMGp1171G0927Q,...    56   7e-08  2
(AM540949) Paracentrotus lividus EST, clone MPMGp1171J2271Q,...    56   8e-08  2
(EL393877) CFFM5335.b1_N14.ab1 CFF(LMS) safflower Carthamus ...    62   8e-08  2
(AR454590) Sequence 63 from patent US 6682888.                     58   8e-08  3
(AM516764) Paracentrotus lividus EST, clone MPMGp1171G1535Q,...    56   8e-08  2
(AM504484) Paracentrotus lividus EST, clone MPMGp1171J221Q, ...    56   8e-08  2
(EE821703) 020605ONLN145086HT ONLN Ovis aries cDNA, mRNA seq...    60   9e-08  2
(ER574841) 1093015809473 Global-Ocean-Sampling_GS-36-01-01-2...    42   1e-07  4
(AC148538) Pan troglodytes clone CH251-167M3, WORKING DRAFT ...    66   2e-07  3
(AC186000) Pan troglodytes BAC clone CH251-167M3 from chromo...    66   2e-07  3
(EH008455) PIC-B-1770 Sus Scrofa Adipocyte Zap Express Libra...    50   2e-07  3
(BP461495) Sus scrofa mRNA, clone:OVRM10196H02, 5' end, expr...    50   2e-07  3
(BJ704025) Ptyochromis sp. 'redtail sheller' cDNA clone:no57...    62   2e-07  2
(CP000655) Polynucleobacter necessarius subsp. asymbioticus ...    58   2e-07  2
(CP000497) Pichia stipitis CBS 6054 chromosome 3, complete s...    58   2e-07  2
(BP146106) Sus scrofa mRNA, clone:OVRM10108A12, 5' end, expr...    50   2e-07  3
(ER443681) 1092963822667 Global-Ocean-Sampling_GS-35-01-01-1...    70   2e-07  1
(EB592761) AGENCOURT_51880091 D. ananassae EST Drosophila an...    70   2e-07  1
(CX532855) s13dNF75G11MJ084_271992 Methyl Jasmonate-Elicited...    70   2e-07  1
(CX529287) s13dNF18F07MJ059_244632 Methyl Jasmonate-Elicited...    70   2e-07  1
(CR853430) Pongo abelii mRNA; EST DKFZp469G137_r1 (from clon...    70   2e-07  1
(CB894828) EST647620 HOGA Medicago truncatula cDNA clone HOG...    70   2e-07  1
(BG453786) NF094A07LF1F1050 Developing leaf Medicago truncat...    70   2e-07  1
(BG448365) NF024C05EC1F1035 Elicited cell culture Medicago t...    70   2e-07  1
(BF648615) NF048B01EC1F1011 Elicited cell culture Medicago t...    70   2e-07  1
(GE929678) G1176P124RF22.T0 Neurospora crassa cDNA - 1 hour ...    70   2e-07  1
(AC115598) Dictyostelium discoideum chromosome 2 map 581427-...    54   2e-07  2
(BP458393) Sus scrofa mRNA, clone:OVRM10153D12, 5' end, expr...    50   2e-07  3
(DN443528) LIB5338-108-A1-K2-D4 LIB5338 Canis lupus familiar...    58   2e-07  2
(EF650280) Tolmerus atricapillus alanyl-tRNA synthetase (AAT...    62   2e-07  2
(EX654888) A_BS-P5-3-H01.ab1 Full-length enriched cDNA from ...    50   2e-07  3
(EX655386) A_BS-P5-9-H07.ab1 Full-length enriched cDNA from ...    50   2e-07  3
(BP282100) Homo sapiens cDNA clone: KMR03273, Sugano cDNA li...    58   2e-07  2
(ER500387) 1093015396748 Global-Ocean-Sampling_GS-35-01-01-1...    60   2e-07  2
(EU436049) Meroplius fukuharai voucher su26 alanyl-tRNA synt...    60   2e-07  2
(DN375632) LIB38529_012_C06_T7_1 LIB38529 Canis lupus famili...    58   2e-07  2
(CN277048) 17000531864156 GRN_EB Homo sapiens cDNA 5', mRNA ...    58   2e-07  2
(DN424095) LIB4216-087-Q1-K1-G3 LIB4216 Canis lupus familiar...    58   2e-07  2
(CN277035) 17000533312418 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   2e-07  2
(BP281787) Homo sapiens cDNA clone: KMR02383, Sugano cDNA li...    58   2e-07  2
(BM834619) K-EST0109627 S11SNU1 Homo sapiens cDNA clone S11S...    58   2e-07  2
(CN277061) 17000532204340 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   2e-07  2
(CN277040) 17000531878272 GRN_EB Homo sapiens cDNA 5', mRNA ...    58   2e-07  2
(CN277051) 17000532613534 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   2e-07  2
(FD624361) susfleck_FC_9_E05 SUSFLECK Fat Cell Sus scrofa cD...    50   3e-07  3
(BE888227) 601511747F1 NIH_MGC_71 Homo sapiens cDNA clone IM...    58   3e-07  2
(BE728330) 601561719F1 NIH_MGC_20 Homo sapiens cDNA clone IM...    58   3e-07  2
(BE387386) 601274465F1 NIH_MGC_20 Homo sapiens cDNA clone IM...    58   3e-07  2
(BP445389) Sus scrofa mRNA, clone:LVR010054E12, 5' end, expr...    50   3e-07  3
(CR984614) RZPD Homo sapiens cDNA expression clone RZPDp9016...    58   3e-07  2
(DB858085) Lipochromis sp. 'matumbi hunter' cDNA clone:hm701...    62   3e-07  2
(BP141942) Sus scrofa mRNA, clone:OVR010003B08, 5' end, expr...    50   3e-07  3
(CN277062) 17000531390060 GRN_EB Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(CN277037) 17000533183280 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(BE892655) 601433466F1 NIH_MGC_72 Homo sapiens cDNA clone IM...    58   3e-07  2
(DR005620) TC119146 Human prostate, large insert, pCMV expre...    58   3e-07  2
(BE407232) 601301350F1 NIH_MGC_21 Homo sapiens cDNA clone IM...    58   3e-07  2
(BG746616) 602703924F1 NIH_MGC_15 Homo sapiens cDNA clone IM...    58   3e-07  2
(CN277058) 17000424715792 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(BG393096) 602411364F1 NIH_MGC_92 Homo sapiens cDNA clone IM...    58   3e-07  2
(CN277033) 17000531860390 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(CN277046) 17000424345637 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(BF794496) 602255742F1 NIH_MGC_85 Homo sapiens cDNA clone IM...    58   3e-07  2
(AC216770) Populus trichocarpa clone POP051-A24, complete se...    62   3e-07  5
(CJ437203) Macaca fascicularis mRNA, clone: QccE-14356, 5' e...    58   3e-07  2
(BW983456) Sus scrofa mRNA, clone:ITT010084C09, 5' end, expr...    50   3e-07  3
(CX873007) HESC4_75_F11.g1_A037 NIH_MGC_262 Homo sapiens cDN...    58   3e-07  2
(CN277050) 17000470834309 GRN_EB Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(CN277054) 17000418252554 GRN_ES Homo sapiens cDNA 5', mRNA ...    58   3e-07  2
(CJ460791) Macaca fascicularis mRNA, clone: QmoA-13601, 5' e...    58   3e-07  2
(ER484180) 1093015286829 Global-Ocean-Sampling_GS-35-01-01-1...    44   3e-07  3
(CV813059) AGENCOURT_36377475 NIH_MGC_280 Homo sapiens cDNA ...    58   3e-07  2
(ER291624) 1092343606702 Global-Ocean-Sampling_GS-34-01-01-1...    54   3e-07  2
(BF796250) 602258542F1 NIH_MGC_85 Homo sapiens cDNA clone IM...    58   3e-07  2
(CX166708) HESC2_43_F10.g1_A035 NIH_MGC_258 Homo sapiens cDN...    58   3e-07  2
(AU143575) Homo sapiens cDNA clone:Y79AA1002151, 5' end, exp...    58   3e-07  2
(DA729968) Homo sapiens cDNA clone NT2RM2004200, 5' end, mRN...    58   3e-07  2
(AU133772) Homo sapiens cDNA clone:OVARC1000630, 5' end, exp...    58   3e-07  2
(DN877952) nae17e02.y1 Dog eye eye minus lens and cornea. Un...    58   3e-07  2
(CJ480864) Macaca fascicularis mRNA, clone: QtrA-16432, 5' e...    58   3e-07  2
(BU543395) AGENCOURT_10327091 NIH_MGC_40 Homo sapiens cDNA c...    58   3e-07  2
(CO249356) AGENCOURT_26529120 NIH_MGC_212 Homo sapiens cDNA ...    58   3e-07  2
(EL512319) CHTX1045.b1_I22.ab1 CHT(XYZ) Jerusalem artichoke ...    64   3e-07  2
(CJ472026) Macaca fascicularis mRNA, clone: QorA-11766, 5' e...    58   3e-07  2
(CD653267) AGENCOURT_14541029 NIA Human H1 Embryonic Stem Ce...    58   3e-07  2
(BU509769) AGENCOURT_10170559 NIH_MGC_71 Homo sapiens cDNA c...    58   3e-07  2
(BU541172) AGENCOURT_10327459 NIH_MGC_40 Homo sapiens cDNA c...    58   3e-07  2
(GE584432) CCPU8776.b1_P10.ab1 CCP(UWX) Globe Artichoke Cyna...    58   3e-07  2
(CD657576) AGENCOURT_14537917 NIA Human H1 Embryonic Stem Ce...    58   3e-07  2
(BU856327) AGENCOURT_10472617 NIH_MGC_109 Homo sapiens cDNA ...    58   3e-07  2
(BG325796) 602424513F1 NIH_MGC_14 Homo sapiens cDNA clone IM...    58   3e-07  2
(BU542116) AGENCOURT_10252890 NIH_MGC_40 Homo sapiens cDNA c...    58   3e-07  2
(BU543182) AGENCOURT_10338621 NIH_MGC_40 Homo sapiens cDNA c...    58   3e-07  2
(BU543413) AGENCOURT_10327109 NIH_MGC_40 Homo sapiens cDNA c...    58   3e-07  2
(BU845565) AGENCOURT_10414149 NIH_MGC_109 Homo sapiens cDNA ...    58   3e-07  2
(CF551910) AGENCOURT_15595775 NIH_MGC_183 Homo sapiens cDNA ...    58   3e-07  2
(BU500380) AGENCOURT_7859849 NIH_MGC_64 Homo sapiens cDNA cl...    58   4e-07  2
(BU844930) AGENCOURT_10412243 NIH_MGC_109 Homo sapiens cDNA ...    58   4e-07  2

>(AF188717) Dictyostelium discoideum alanyl-tRNA synthetase (AlaS)
           mRNA, complete cds.
          Length = 2924

 Score =  963 bits (486), Expect(5) = 0.0
 Identities = 486/486 (100%)
 Strand = Plus / Plus


Query: 77  agagagaaatatgaacatacatttgttccatcatcagcagtaattccacatgatgatcca 136
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77  agagagaaatatgaacatacatttgttccatcatcagcagtaattccacatgatgatcca 136


Query: 137 actttattatttgcaaatgcaggtatgaatcaatttaaaccaatctttttaggacaagtt 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 actttattatttgcaaatgcaggtatgaatcaatttaaaccaatctttttaggacaagtt 196


Query: 197 aatccaaaatcagaacaagcaaaattgaagagagcagtcaatagtcaaaaatgtattcgt 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 aatccaaaatcagaacaagcaaaattgaagagagcagtcaatagtcaaaaatgtattcgt 256


Query: 257 gcaggtggtaaacataatgatttggatgatgtaggtaaggatacttatcatcacaccttc 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 gcaggtggtaaacataatgatttggatgatgtaggtaaggatacttatcatcacaccttc 316


Query: 317 tttgagatgttgggtaattggtcatttggcaattactttaagaaggaggcaatcacttgg 376
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 317 tttgagatgttgggtaattggtcatttggcaattactttaagaaggaggcaatcacttgg 376


Query: 377 gcatgggaattattgacagaggtatacaaattagataaagaacgtttatatgtcacttac 436
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 gcatgggaattattgacagaggtatacaaattagataaagaacgtttatatgtcacttac 436


Query: 437 tttagaggtgacccagagaaaggattggaagcagatctcgaagcaaagaacctttggttg 496
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 437 tttagaggtgacccagagaaaggattggaagcagatctcgaagcaaagaacctttggttg 496


Query: 497 caatatttaccagaggaacgtgtgctcccattcggtatgaaagagaacttttgggagatg 556
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 497 caatatttaccagaggaacgtgtgctcccattcggtatgaaagagaacttttgggagatg 556


Query: 557 ggtgac 562
           ||||||
Sbjct: 557 ggtgac 562

 Score =  543 bits (274), Expect(5) = 0.0
 Identities = 274/274 (100%)
 Strand = Plus / Plus


Query: 780  ttcaaactaaatcaccaatgactgcaatcatgttaattagtccagatgaagaaaaaggta 839
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2616 ttcaaactaaatcaccaatgactgcaatcatgttaattagtccagatgaagaaaaaggta 2675


Query: 840  aagttacttgcattggtatcgttccaaaagattctgaaatctcaaaaactttaactgcaa 899
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2676 aagttacttgcattggtatcgttccaaaagattctgaaatctcaaaaactttaactgcaa 2735


Query: 900  atgcttgggttgtaaaggttaccgaagttttaggtggtaaaggtggtggtaaagttgatg 959
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2736 atgcttgggttgtaaaggttaccgaagttttaggtggtaaaggtggtggtaaagttgatg 2795


Query: 960  ttgctcaaggtgttggttctaaattagataaaatcgatgaagctattctcgtttcaagag 1019
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2796 ttgctcaaggtgttggttctaaattagataaaatcgatgaagctattctcgtttcaagag 2855


Query: 1020 aatttgcaaatgcaaactgattcaaattatcttt 1053
            ||||||||||||||||||||||||||||||||||
Sbjct: 2856 aatttgcaaatgcaaactgattcaaattatcttt 2889

 Score =  396 bits (200), Expect(5) = 0.0
 Identities = 200/200 (100%)
 Strand = Plus / Plus


Query: 573  ttcgtatgaatttggttgaaactttgaaggaagttcaagcactccaaagaaaacaagtca 632
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2409 ttcgtatgaatttggttgaaactttgaaggaagttcaagcactccaaagaaaacaagtca 2468


Query: 633  aagaacaagaaaccatcttggctcaacaagctcaaacctatttagagaaaacctctgaag 692
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2469 aagaacaagaaaccatcttggctcaacaagctcaaacctatttagagaaaacctctgaag 2528


Query: 693  aattggctaaatctcaaccaaaggttttcgtagatttagtaaacttcaattcaaatactc 752
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2529 aattggctaaatctcaaccaaaggttttcgtagatttagtaaacttcaattcaaatactc 2588


Query: 753  ctttaatcactgaaaccatt 772
            ||||||||||||||||||||
Sbjct: 2589 ctttaatcactgaaaccatt 2608

 Score = 67.9 bits (34), Expect(5) = 0.0
 Identities = 34/34 (100%)
 Strand = Plus / Plus


Query: 36 tggatgttaatcaaattagaaaaacttttatcga 69
          ||||||||||||||||||||||||||||||||||
Sbjct: 36 tggatgttaatcaaattagaaaaacttttatcga 69

 Score = 54.0 bits (27), Expect(5) = 0.0
 Identities = 27/27 (100%)
 Strand = Plus / Plus


Query: 1  ggaaggagatataaaatataaaagaag 27
          |||||||||||||||||||||||||||
Sbjct: 1  ggaaggagatataaaatataaaagaag 27

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 105743758
Number of Hits to DB: 1,298,032,799
Number of extensions: 76167442
Number of successful extensions: 6156205
Number of sequences better than 10.0: 1474
Length of query: 1088
Length of database: 104,622,809,269
Length adjustment: 24
Effective length of query: 1064
Effective length of database: 102,084,959,077
Effective search space: 108618396457928
Effective search space used: 108618396457928
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)




Dictyostelium discoideum cDNA Project Home