Homology FC-BC01 vs DNA
Query= FC-BC01 (FC-BC01Q) /CSM/FC/FC-BC/FC-BC01Q.Seq.d/
(1088 letters)
Database: ddbj_B
105,743,758 sequences; 104,622,809,269 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value N
(AF188717) Dictyostelium discoideum alanyl-tRNA synthetase (... 963 0.0 5
(C25775) Dictyostelium discoideum gamete cDNA, clone FC-BC01. 963 0.0 3
(BJ397108) Dictyostelium discoideum cDNA clone:dds45h06, 5' ... 955 0.0 3
(BJ332266) Dictyostelium discoideum cDNA clone:dda38c18, 5' ... 955 0.0 3
(BJ423300) Dictyostelium discoideum cDNA clone:ddv48a22, 5' ... 955 0.0 3
(BJ335055) Dictyostelium discoideum cDNA clone:dda48c21, 5' ... 955 0.0 3
(BJ391666) Dictyostelium discoideum cDNA clone:dds24c19, 5' ... 955 0.0 3
(BJ330331) Dictyostelium discoideum cDNA clone:dda31n02, 5' ... 955 0.0 2
(BJ419982) Dictyostelium discoideum cDNA clone:ddv37h23, 5' ... 955 0.0 2
(BJ331551) Dictyostelium discoideum cDNA clone:dda35i23, 5' ... 936 0.0 3
(BJ396840) Dictyostelium discoideum cDNA clone:dds44l02, 5' ... 946 0.0 2
(BJ357242) Dictyostelium discoideum cDNA clone:dda62k23, 3' ... 543 0.0 2
(C25776) Dictyostelium discoideum gamete cDNA, clone FC-BC01. 543 0.0 2
(AU284810) Dictyostelium discoideum gamete cDNA clone:FC-BL1... 527 0.0 2
(BJ443258) Dictyostelium discoideum cDNA clone:ddv52k08, 3' ... 509 0.0 3
(BJ403335) Dictyostelium discoideum cDNA clone:dds24f21, 3' ... 509 0.0 3
(BJ408864) Dictyostelium discoideum cDNA clone:dds47p04, 3' ... 509 0.0 3
(BJ442064) Dictyostelium discoideum cDNA clone:ddv48a22, 3' ... 509 0.0 3
(BJ406731) Dictyostelium discoideum cDNA clone:dds36c10, 3' ... 502 0.0 3
(BJ348906) Dictyostelium discoideum cDNA clone:dda34b20, 3' ... 509 0.0 2
(BJ407396) Dictyostelium discoideum cDNA clone:dds38m12, 3' ... 505 0.0 2
(BJ355836) Dictyostelium discoideum cDNA clone:dda58j12, 3' ... 509 0.0 2
(BJ438412) Dictyostelium discoideum cDNA clone:ddv37h23, 3' ... 509 0.0 2
(BJ353037) Dictyostelium discoideum cDNA clone:dda48c21, 3' ... 484 0.0 3
(BJ347787) Dictyostelium discoideum cDNA clone:dda31n02, 3' ... 498 0.0 3
(BJ405958) Dictyostelium discoideum cDNA clone:dds33j17, 3' ... 484 0.0 2
(BJ349244) Dictyostelium discoideum cDNA clone:dda35i23, 3' ... 484 0.0 3
(BJ352216) Dictyostelium discoideum cDNA clone:dda46e01, 3' ... 513 0.0 2
(BJ407940) Dictyostelium discoideum cDNA clone:dds44l02, 3' ... 511 0.0 2
(BJ385697) Dictyostelium discoideum cDNA clone:ddc55h22, 3' ... 511 0.0 2
(BJ445128) Dictyostelium discoideum cDNA clone:ddv58d13, 3' ... 504 0.0 2
(BJ406132) Dictyostelium discoideum cDNA clone:dds34c08, 3' ... 504 0.0 2
(BJ408217) Dictyostelium discoideum cDNA clone:dds45h06, 3' ... 486 0.0 3
(BJ441893) Dictyostelium discoideum cDNA clone:ddv48n04, 3' ... 484 0.0 3
(BJ445194) Dictyostelium discoideum cDNA clone:ddv58b19, 3' ... 494 0.0 2
(BJ403135) Dictyostelium discoideum cDNA clone:dds24m04, 3' ... 446 0.0 2
(BJ350047) Dictyostelium discoideum cDNA clone:dda38c18, 3' ... 476 0.0 3
(BJ394213) Dictyostelium discoideum cDNA clone:dds34c08, 5' ... 642 0.0 3
(BJ370892) Dictyostelium discoideum cDNA clone:ddc55h22, 5' ... 632 0.0 3
(BJ394727) Dictyostelium discoideum cDNA clone:dds36c10, 5' ... 585 e-179 3
(BJ391681) Dictyostelium discoideum cDNA clone:dds24f21, 5' ... 583 e-178 3
(BJ426368) Dictyostelium discoideum cDNA clone:ddv58b19, 5' ... 636 e-178 1
(BJ370154) Dictyostelium discoideum cDNA clone:ddc53h04, 5' ... 593 e-176 2
(BJ424420) Dictyostelium discoideum cDNA clone:ddv52k08, 5' ... 571 e-173 3
(BJ391505) Dictyostelium discoideum cDNA clone:dds24m04, 5' ... 561 e-155 1
(BJ441492) Dictyostelium discoideum cDNA clone:ddv46j24, 3' ... 383 e-152 2
(BJ403376) Dictyostelium discoideum cDNA clone:dds24n23, 3' ... 406 e-109 1
(BJ426300) Dictyostelium discoideum cDNA clone:ddv58d13, 5' ... 402 e-107 1
(AM758901) Clytia hemisphaerica EST, 5' end sequence, clone ... 129 1e-38 5
(BJ383459) Dictyostelium discoideum cDNA clone:ddc53h04, 3' ... 143 4e-37 2
(BM952188) rc56d10.y1 Meloidogyne hapla egg pAMP1 v1 Meloido... 109 5e-35 3
(DB741542) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB730908) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB754014) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB737382) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB750171) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB754654) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB735185) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB745180) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(DB732732) Apis mellifera head cDNA, RIKEN full-length enric... 105 9e-34 2
(EE003797) ROE00012109 Rhizopus oryzae Company Rhizopus oryz... 137 4e-33 3
(EE004920) ROE00005214 Rhizopus oryzae Company Rhizopus oryz... 137 5e-33 3
(EJ536019) 1092955259340 Global-Ocean-Sampling_GS-29-01-01-1... 117 1e-32 2
(EF650269) Mydas clavatus alanyl-tRNA synthetase (AATS) gene... 129 6e-32 3
(BJ423140) Dictyostelium discoideum cDNA clone:ddv48n04, 5' ... 151 7e-32 1
(DB751745) Apis mellifera head cDNA, RIKEN full-length enric... 105 2e-31 2
(BI926102) EST545991 tomato flower, buds 0-3 mm Solanum lyco... 131 2e-31 2
(CK248639) EST732276 potato callus cDNA library, normalized ... 131 2e-31 2
(CK243374) EST727011 potato callus cDNA library, normalized ... 131 3e-31 2
(CK249522) EST733159 potato callus cDNA library, normalized ... 131 3e-31 2
(CK243373) EST727010 potato callus cDNA library, normalized ... 131 3e-31 2
(CK247842) EST731479 potato callus cDNA library, normalized ... 131 3e-31 2
(DB730693) Apis mellifera head cDNA, RIKEN full-length enric... 105 6e-31 3
(DB743924) Apis mellifera head cDNA, RIKEN full-length enric... 98 6e-31 3
(EJ550067) 1092959435222 Global-Ocean-Sampling_GS-29-01-01-1... 117 1e-30 2
(DB710460) Solanum lycopersicum cDNA, clone: LEFL2005G03, 5'... 131 2e-29 2
(CX700207) 87044.1 Stolon Solanum tuberosum cDNA clone 87044... 131 6e-29 2
(FF770641) XABT73054.fwd Gateway compatible cien cDNA librar... 100 3e-28 3
(FF763874) XABT68670.fwd Gateway compatible cien cDNA librar... 100 3e-28 3
(FK064919) XABT126844.b1 Gateway compatible cien cDNA librar... 100 3e-28 3
(FF747919) XABT57365.fwd Gateway compatible cien cDNA librar... 103 4e-28 3
(DB718907) Solanum lycopersicum cDNA, clone: LEFL2030F17, 5'... 131 8e-28 2
(DK954596) Adiantum capillus-veneris mRNA, clone: TST39A01NG... 64 1e-27 4
(GE721735) CBUP8994.b1 B.anynana_wing.4-6d_2-10kb Bicyclus a... 74 2e-26 3
(FE414084) CBTU4347.fwd CBTU_Daphnia_pulex_Chosen_One_Librar... 80 6e-26 3
(DB726216) Solanum lycopersicum cDNA, clone: LEFL2051L09, 5'... 131 6e-26 1
(BE434392) EST405470 tomato breaker fruit, TIGR Solanum lyco... 131 6e-26 1
(FK108934) XABT154938.b1 Gateway compatible cien cDNA librar... 96 2e-25 2
(FF754328) XABT61824.fwd Gateway compatible cien cDNA librar... 96 2e-25 2
(DL173609) Methods for Identifying the Target of a Compound ... 74 3e-25 3
(AX489169) Sequence 6469 from Patent WO02053728. 74 3e-25 3
(FF785176) XABT82941.fwd Gateway compatible cien cDNA librar... 88 8e-25 3
(FF764853) XABT69304.fwd Gateway compatible cien cDNA librar... 88 8e-25 3
(FK096265) XABT146131.b1 Gateway compatible cien cDNA librar... 88 8e-25 3
(FF880130) CBWU20425.b1 Yutaka Satou unpublished cDNA librar... 88 9e-25 3
(FK108377) XABT154603.b1 Gateway compatible cien cDNA librar... 88 9e-25 3
(FF753544) XABT61304.fwd Gateway compatible cien cDNA librar... 88 9e-25 3
(FK066065) XABT127510.b1 Gateway compatible cien cDNA librar... 88 9e-25 3
(FF808848) XABT98988.fwd Gateway compatible cien cDNA librar... 88 1e-24 3
(FK132701) XABT169518.b1 Gateway compatible cien cDNA librar... 88 1e-24 3
(FF804542) XABT95734.fwd Gateway compatible cien cDNA librar... 88 1e-24 3
(FF856506) CBWU5921.b1 Yutaka Satou unpublished cDNA library... 88 1e-24 3
(FF716295) XABT35011.fwd Gateway compatible cien cDNA librar... 88 1e-24 3
(DB581127) Halocynthia roretzi cDNA clone:ma310e14, 5' end. 101 3e-24 2
(DB718441) Solanum lycopersicum cDNA, clone: LEFL2028P24, 5'... 125 4e-24 1
(DY885130) CeleSEQ324 Cunninghamella elegans pBluescript (Ec... 82 1e-23 2
(DY893572) CeleSEQ12947 Cunninghamella elegans pBluescript (... 82 1e-23 2
(EF650292) Laxenecera albicincta alanyl-tRNA synthetase (AAT... 123 2e-23 1
(CT856288) Oryza sativa Indica Group EST sequence:OSIGCRA218... 88 2e-23 2
(BW081340) Ciona intestinalis cDNA, clone:rcieg085a05, 3' en... 88 2e-23 2
(BW217139) Ciona intestinalis cDNA, clone:cieg085a05, 5' end... 88 3e-23 2
(FK069080) XABT129327.b1 Gateway compatible cien cDNA librar... 88 3e-23 2
(FF736228) XABT49480.fwd Gateway compatible cien cDNA librar... 88 7e-23 3
(EF650267) Mitrodetus dentitarsis alanyl-tRNA synthetase (AA... 105 1e-22 2
(FF629942) G825P539RF1.T0 Acorn worm normalized gastrula pEx... 94 2e-22 3
(FF477569) G613P6177RG8.T0 Acorn worm blastula/gastrula pCMV... 94 2e-22 3
(EF650291) Lamyra gulo alanyl-tRNA synthetase (AATS) gene, p... 119 2e-22 1
(EF650289) Cerotainia albipilosa alanyl-tRNA synthetase (AAT... 117 1e-21 1
(DB958360) Glycine max cDNA, clone: GMFL02-09-B13, 5'end. 117 1e-21 1
(FK653723) 454GmaGlobSeed388355 Soybean Seeds Containing Glo... 117 1e-21 1
(DL265432) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS. 80 3e-21 3
(DJ131881) Method for identification of useful proteins deri... 80 3e-21 3
(HA140800) Sequence 2501 from Patent WO2006024892. 80 3e-21 3
(EF650294) Pilica formidolosa alanyl-tRNA synthetase (AATS) ... 115 4e-21 1
(EF650293) Nusa infumata alanyl-tRNA synthetase (AATS) gene,... 115 4e-21 1
(AR548989) Sequence 4120 from patent US 6747137. 74 5e-21 2
(CZ285790) cp43c11.f Candida parapsilosis Random Genomic Lib... 64 8e-21 4
(FN026924) Petunia axillaris subsp. axillaris EST, clone drs... 109 4e-20 2
(FN025781) Petunia axillaris subsp. axillaris EST, clone drs... 101 4e-20 3
(M55993) B.mori alanyl-tRNA synthetase mRNA, complete cds. 68 5e-20 3
(BH535766) BOGIL41TR BOGI Brassica oleracea genomic clone BO... 111 6e-20 1
(FI739580) BOT01-90F1TR BOT01 Brassica oleracea genomic clon... 111 6e-20 1
(FG913287) UCRVU08_CCNS8741_b4 Cowpea IT97K-461-4 Mixed Tiss... 111 6e-20 1
(FG808493) UCRVU04_CCNI10479_b1 Cowpea 524B Mixed Tissue and... 111 6e-20 1
(AZ917266) 4911.fd64h15.x1 Saccharomyces bayanus MCYC 623-6C... 100 9e-20 2
(AX831298) Sequence 2018 from Patent WO03072602. 80 9e-20 3
(AX820268) Sequence 2018 from Patent EP1338608. 80 9e-20 3
(DL344315) METHODS FOR ANALYZING GENES OF INDUSTRIAL YEASTS. 80 1e-19 3
(DJ210764) Method for identification of useful proteins deri... 80 1e-19 3
(HA291715) Sequence 81384 from Patent WO2006024892. 80 1e-19 3
(FF613444) G825P5173RE7.T0 Acorn worm normalized gastrula pE... 94 1e-19 3
(FC229805) CAGG2744.fwd CAGG Nematostella vectensis Nemve Ea... 109 2e-19 2
(DQ332533) Synthetic construct Saccharomyces cerevisiae clon... 80 2e-19 3
(U18672) Saccharomyces cerevisiae cytoplasmic alanyl-tRNA sy... 80 2e-19 3
(I42578) Sequence 3 from patent US 5629188. 80 2e-19 3
(EU436027) Icaridion debile voucher su2 alanyl-tRNA syntheta... 109 2e-19 1
(Z75243) S.cerevisiae chromosome XV reading frame ORF YOR335c. 80 3e-19 3
(GD055128) KS13039B03 KS13 Capsicum annuum cDNA, mRNA sequence. 86 6e-19 3
(CO087450) GR__Ea05O17.f GR__Ea Gossypium raimondii cDNA clo... 90 8e-19 3
(EF650306) Lycostommyia albifacies alanyl-tRNA synthetase (A... 100 2e-18 2
(EF650327) Neoitamus cyanurus alanyl-tRNA synthetase (AATS) ... 86 2e-18 2
(EF650319) Holcocephala calva alanyl-tRNA synthetase (AATS) ... 92 2e-18 2
(EU436057) Saltella bezzii voucher su39 alanyl-tRNA syntheta... 72 2e-18 2
(FF429787) G142P60110RG4.T0 Acorn worm juvenile pCMVSport6 l... 94 2e-18 2
(GO603817) NBERO1CH_T3_041_H07_09JUL2006_049 NBERO1CH Nicoti... 88 2e-18 2
(FG158666) AGN_RNC023xk22f1.ab1 AGN_RNC Nicotiana tabacum cD... 88 3e-18 2
(CG821418) SOYAS73TV LargeInsertSoybeanGenLib Glycine max ge... 105 4e-18 1
(AL431245) T7 end of clone BB0AA002G10 of library BB0AA from... 66 5e-18 3
(AR319950) Sequence 2500 from patent US 6562958. 54 1e-17 4
(AC189427) Brassica rapa subsp. pekinensis clone KBrB065N20,... 103 1e-17 1
(EF650290) Choerades bella alanyl-tRNA synthetase (AATS) gen... 103 1e-17 1
(FD543949) RR2FR22TF RR2(MS) Raphanus raphanistrum subsp. ra... 103 1e-17 1
(Z49821) S.cerevisiae PDR10, MYO2, PDR10, SCD5, MIP1, ALA1, ... 80 2e-17 3
(CJ366476) Molgula tectiformis cDNA, gastrula/neurula clone:... 92 2e-17 2
(EF650270) Afroleptomydas sp. 'Clanwilliam' alanyl-tRNA synt... 92 2e-17 2
(DW492730) GH_RMIRS_093_A08_F Cotton Normalized Library rand... 90 3e-17 2
(CJ392091) Molgula tectiformis cDNA, gonad clone:mtgd018j02,... 92 3e-17 2
(EF650268) Opomydas townsendi alanyl-tRNA synthetase (AATS) ... 92 3e-17 2
(CJ393083) Molgula tectiformis cDNA, gonad clone:mtgd008g13,... 92 3e-17 2
(DW492731) GH_RMIRS_093_A08_R Cotton Normalized Library rand... 90 3e-17 2
(AI726299) BNLGHi5539 Six-day Cotton fiber Gossypium hirsutu... 90 3e-17 2
(DV617176) EST1220172 Glossina morsitans morsitans Fat body ... 50 5e-17 4
(GE729690) CBUH3406.b1 B.anynana_wing.LCPP_2-10kb Bicyclus a... 66 1e-16 2
(EL600367) He_pwd_0136F12_M13R Heliconius erato pooled wing ... 54 1e-16 3
(EX811978) CBNA2681.fwd CBNA Phycomyces blakesleeanus NRRL15... 100 1e-16 2
(EX817996) CBNA5866.fwd CBNA Phycomyces blakesleeanus NRRL15... 100 1e-16 2
(EX847212) CBNC6781.fwd CBNC Phycomyces blakesleeanus NRRL15... 100 1e-16 2
(EX848264) CBNC7310.fwd CBNC Phycomyces blakesleeanus NRRL15... 100 1e-16 2
(DT662487) He_wd2a1_72H06_M13R Heliconius erato wing disk 2 ... 54 1e-16 3
(DT665565) He_wd2a1_52A01_M13R Heliconius erato wing disk 2 ... 54 2e-16 3
(Z22673) A.thaliana tRNA synthetase. 100 2e-16 1
(BT008807) Arabidopsis thaliana At1g50200 gene, complete cds. 100 2e-16 1
(BT008649) Arabidopsis thaliana clone RAFL09-78-D07 (R19577)... 100 2e-16 1
(BT002526) Arabidopsis thaliana Unknown protein mRNA, comple... 100 2e-16 1
(AK226885) Arabidopsis thaliana mRNA for putative alanine--t... 100 2e-16 1
(AC007980) Arabidopsis thaliana chromosome I BAC F14I3 genom... 100 2e-16 1
(CQ804806) Sequence 1217 from Patent WO2004035798. 100 2e-16 1
(EF650288) Atomosia puella alanyl-tRNA synthetase (AATS) gen... 100 2e-16 1
(EG525580) AYAXO28TF pooled cDNA populations Arabidopsis tha... 100 2e-16 1
(EG485831) AYASN68TR pooled cDNA populations Arabidopsis tha... 100 2e-16 1
(AV529902) Arabidopsis thaliana cDNA clone:APZL51f06R, 5' end. 100 2e-16 1
(AV528274) Arabidopsis thaliana cDNA clone:APZL05b11R, 5' end. 100 2e-16 1
(BP562614) Arabidopsis thaliana cDNA clone:RAFL09-97-M18, 5'... 100 2e-16 1
(EU436059) Saltella sphondylii voucher su41 alanyl-tRNA synt... 62 3e-16 3
(CR382133) Debaryomyces hansenii strain CBS767 chromosome A ... 74 1e-15 3
(CR858480) Pongo abelii mRNA; cDNA DKFZp459G207 (from clone ... 82 3e-15 3
(AM469609) Vitis vinifera contig VV78X203805.6, whole genome... 76 3e-15 3
(EU436058) Saltella nigripes voucher su40 alanyl-tRNA synthe... 96 4e-15 1
(EF650295) Laphystia tolandi alanyl-tRNA synthetase (AATS) g... 96 4e-15 1
(FK924246) EST_lsal_evj_957020 lsalevj mixed_tissue_mixed_st... 96 4e-15 1
(EU436048) Lasionemopoda hirsuta voucher su25 alanyl-tRNA sy... 92 5e-15 2
(EK272688) 1095462264906 Global-Ocean-Sampling_GS-31-01-01-1... 54 6e-15 4
(CN571925) rf35b08.x1 Meloidogyne hapla J2 pAMP1 v1 Meloidog... 94 1e-14 1
(EU436028) Gluma nitida voucher su3 alanyl-tRNA synthetase (... 62 2e-14 3
(DT662478) He_wd2a1_72G04_M13R Heliconius erato wing disk 2 ... 54 3e-14 3
(CV708473) UCRPT01_0011G02_r Poncirus trifoliata CTV-challen... 90 3e-14 2
(GH105045) G993P134RK23.T0 Neurospora crassa cDNA - 1 hour G... 82 3e-14 2
(GE957862) G1176P158RM21.T1 Neurospora crassa cDNA - 1 hour ... 82 3e-14 2
(CR787743) Pongo abelii mRNA; EST DKFZp468I2329_r1 (from clo... 82 3e-14 2
(GH089737) G993P113RE21.T0 Neurospora crassa cDNA - 1 hour G... 82 3e-14 2
(GE948105) G1176P149RH22.T0 Neurospora crassa cDNA - 1 hour ... 82 3e-14 2
(GE957924) G1176P158RM21.T0 Neurospora crassa cDNA - 1 hour ... 82 3e-14 2
(GE944381) G1176P141RF2.T0 Neurospora crassa cDNA - 1 hour O... 82 3e-14 2
(CR629714) Pongo abelii mRNA; EST DKFZp469M0521_r1 (from clo... 82 3e-14 2
(EY681459) CS00-C1-650-022-C03-CT.F Sweet orange leaf, young... 90 3e-14 2
(CD576239) UCRPT01_03de07_g3 Poncirus trifoliata CTV-challen... 90 3e-14 2
(EY764718) CR05-C1-100-063-F02-CT.F Mandarin leaf, greenhous... 90 3e-14 2
(FC892464) IC0AAA21DD03RM1 IVIA1 Citrus clementina cDNA clon... 90 3e-14 2
(EY679970) CS00-C1-650-006-A06-CT.F Sweet orange leaf, young... 90 3e-14 2
(EF207962) Heliconius erato alanyl-tRNA synthetase-like (Aat... 54 3e-14 3
(DV182174) CT001_D11_CT001_3700_91.ab1 C. tentans tissue cul... 64 3e-14 2
(FC906727) IC0AAA1BD12RM1 IVIA1 Citrus clementina cDNA clone... 90 3e-14 2
(EY767503) CR05-C1-102-017-A11-CT.F Mandarin leaf, infected ... 90 3e-14 2
(FC898206) IC0AAA20BF11RM1 IVIA1 Citrus clementina cDNA clon... 90 4e-14 2
(FC880530) IC0AAA37AC07RM1 IVIA1 Citrus clementina cDNA clon... 90 4e-14 2
(DY266596) IC0AAA1BD12RM1 CitNFL Citrus clementina cDNA 5', ... 90 4e-14 2
(DY267065) IC0AAA20BF11RM1 CitNFL Citrus clementina cDNA 5',... 90 5e-14 2
(DY267573) IC0AAA21DD03RM1 CitNFL Citrus clementina cDNA 5',... 90 5e-14 2
(DY274573) IC0AAA37AC07RM1 CitNFL Citrus clementina cDNA 5',... 90 5e-14 2
(AM450310) Vitis vinifera contig VV78X124834.14, whole genom... 72 5e-14 3
(EF650310) Scylaticus costalis alanyl-tRNA synthetase (AATS)... 92 5e-14 1
(CX159373) DV01207.5prime DV Drosophila virilis Embryo Droso... 92 5e-14 1
(CR382126) Kluyveromyces lactis strain NRRL Y-1140 chromosom... 78 7e-14 3
(GH101196) G993P128RL9.T0 Neurospora crassa cDNA - 1 hour Gl... 82 1e-13 2
(FC647276) CAXU8955.fwd CAXU Lottia gigantea from female gon... 88 1e-13 2
(EK041560) 1092959522921 Global-Ocean-Sampling_GS-31-01-01-1... 68 1e-13 2
(GH097135) G993P121RP2.T0 Neurospora crassa cDNA - 1 hour Gl... 82 1e-13 2
(GE540731) CCHS27160.b1_O22.ab1 CCHS Espina Barnadesia spino... 80 1e-13 2
(GH090934) G993P18FI10.T0 Neurospora crassa cDNA - 1 hour Gl... 82 1e-13 2
(AC225511) Medicago truncatula clone mth2-88i1, complete seq... 90 2e-13 1
(FH287845) CHO_OF4201xp07f1.ab1 CHO_OF4 Nicotiana tabacum ge... 90 2e-13 1
(CV712141) UCRPT01_0016P23_r Poncirus trifoliata CTV-challen... 90 2e-13 1
(CV709297) UCRPT01_0012K10_r Poncirus trifoliata CTV-challen... 90 2e-13 1
(CB417303) EST0379 Mature peel (flavedo) cDNA subtraction li... 90 2e-13 1
(BQ869008) QGD4e08.yg.ab1 QG_ABCDI lettuce salinas Lactuca s... 90 2e-13 1
(EY762553) CR05-C1-100-055-G10-CT.F Mandarin leaf, greenhous... 90 2e-13 1
(EY738956) CS00-C3-705-050-C10-CT.F Sweet orange fruit, deve... 90 2e-13 1
(EY656406) CS00-C1-100-119-D02-CT.F Sweet orange leaf, green... 90 2e-13 1
(AV830219) Arabidopsis thaliana cDNA clone:RAFL09-64-P04, 5'... 90 2e-13 1
(FM992693) Candida dubliniensis CD36 chromosome 6, complete ... 74 3e-13 11
(CX178486) E12_45-121_10.ab1 leaf inoculated with Marssonia ... 62 4e-13 3
(CK446639) pncs907aA05.SP6 Aspergillus nidulans negative sub... 78 4e-13 2
(EB609121) AGENCOURT_56953483 D. grimshawi EST Drosophila gr... 86 4e-13 2
(GE922574) G1176P110RF13.T0 Neurospora crassa cDNA - 1 hour ... 82 4e-13 2
(GH088705) G993P110RM16.T0 Neurospora crassa cDNA - 1 hour G... 82 4e-13 2
(DY963514) CLSM13766.b1_L10.ab1 CLS(LMS) lettuce sativa Lact... 82 5e-13 2
(DT501783) WS01314.BR_D07 PTxD-IL-FL-A-4 Populus trichocarpa... 62 6e-13 3
(AV413970) Lotus japonicus cDNA clone:MWM238a07_r, 5' end. 88 9e-13 1
(EX059700) BR044344 salt-treated whole plant cDNA library KB... 88 9e-13 1
(EF650265) Phycus frommeri alanyl-tRNA synthetase (AATS) gen... 74 1e-12 2
(EU410379) Ospriocerus aeacus voucher Asil-370 alanyl-tRNA s... 70 1e-12 2
(CK290840) EST753554 Nicotiana benthamiana mixed tissue cDNA... 68 2e-12 2
(CK289717) EST752439 Nicotiana benthamiana mixed tissue cDNA... 68 2e-12 2
(EU436054) Palaeosepsis pusio voucher su33 alanyl-tRNA synth... 86 3e-12 1
(EF148384) Populus trichocarpa x Populus deltoides clone WS0... 62 4e-12 3
(GO332523) VBL6_39_F23_E001.g1 Normalized cDNA library from ... 74 5e-12 2
(EF650304) Connomyia varipennis alanyl-tRNA synthetase (AATS... 52 5e-12 2
(BQ408844) GA__Ed0012D07r Gossypium arboreum 7-10 dpa fiber ... 82 6e-12 2
(EY769513) CR05-C1-102-002-A04-CT.F Mandarin leaf, infected ... 82 7e-12 2
(DW484034) GH_RMIRS_045_B09_F Cotton Normalized Library rand... 82 7e-12 2
(DW484033) GH_RMIRS_045_B09_077_R Cotton Normalized Library ... 82 8e-12 2
(EF650296) Trichardis sp. TD-2008 alanyl-tRNA synthetase (AA... 84 1e-11 1
(EB556236) AGENCOURT_51203776 D. virilis EST Drosophila viri... 84 1e-11 1
(BP189739) Dugesia japonica cDNA, clone: 02205_HH, expressed... 84 1e-11 1
(GP280038) Sequence 12218 from patent US 7504493. 80 2e-11 8
(DJ025883) Genome-wide DNA marker of Saccharomyces cerevisiae. 80 2e-11 8
(DX971482) CHORI105-20C11.TV.2 CHORI105.pTARBAC1.3 Trypanoso... 68 2e-11 3
(EC134092) HVE00009680 Hartmannella vermiformis Normalized l... 48 2e-11 3
(AM600114) Paracentrotus lividus EST, clone MPMGp1174G2271Q,... 64 2e-11 2
(GE932098) G1176P120RI8.T0 Neurospora crassa cDNA - 1 hour O... 82 2e-11 2
(FC674836) CAXX10263.fwd CAXX Lottia gigantea from male gona... 80 3e-11 2
(FC819793) Sr_pAMT7_015n20_T7 S. ratti mixed stage pAMP Stro... 74 3e-11 2
(BJ370418) Dictyostelium discoideum cDNA clone:ddc54f05, 5' ... 54 3e-11 3
(EH083343) PMEAO09TR Perkinsus marinus large insert cDNA lib... 58 3e-11 2
(AC206538) Pongo abelii BAC clone CH276-53E8 from chromosome... 82 4e-11 4
(EU436026) Lopa convexa voucher su1 alanyl-tRNA synthetase (... 44 4e-11 4
(EF650284) Molobratia teutonus alanyl-tRNA synthetase (AATS)... 64 5e-11 3
(CU329670) Schizosaccharomyces pombe chromosome I. 82 5e-11 1
(AC125476) Medicago truncatula clone mth2-10e13, complete se... 82 5e-11 1
(EU436031) Archisepsis excavata voucher su8 alanyl-tRNA synt... 82 5e-11 1
(DW048291) CLLX14895.b1_N04.ab1 CLL(XYZ) lettuce saligna Lac... 82 5e-11 1
(DT573462) EST1084102 GH_TMO Gossypium hirsutum cDNA, mRNA s... 82 5e-11 1
(CR789057) Pongo abelii mRNA; EST DKFZp468F0932_r1 (from clo... 82 5e-11 1
(CR554880) Pongo abelii mRNA; EST DKFZp469K0114_r1 (from clo... 82 5e-11 1
(CR543395) Pongo abelii mRNA; EST DKFZp459G098_r1 (from clon... 82 5e-11 1
(BM358474) GA__Ea0009K01r Gossypium arboreum 7-10 dpa fiber ... 82 5e-11 1
(BM358439) GA__Ea0009E13r Gossypium arboreum 7-10 dpa fiber ... 82 5e-11 1
(GH110681) G993P141RB9.T0 Neurospora crassa cDNA - 1 hour Gl... 82 5e-11 1
(GH110522) G993P141FB9.T0 Neurospora crassa cDNA - 1 hour Gl... 82 5e-11 1
(GH096054) G993P119RM23.T0 Neurospora crassa cDNA - 1 hour G... 82 5e-11 1
(GE945869) G1176P144RB19.T0 Neurospora crassa cDNA - 1 hour ... 82 5e-11 1
(BJ419749) Dictyostelium discoideum cDNA clone:ddv37g05, 5' ... 54 5e-11 3
(BJ418823) Dictyostelium discoideum cDNA clone:ddv34k03, 5' ... 54 5e-11 3
(GE930425) G1176P124RK11.T0 Neurospora crassa cDNA - 1 hour ... 48 5e-11 3
(BJ421875) Dictyostelium discoideum cDNA clone:ddv44j05, 5' ... 54 5e-11 3
(BJ421195) Dictyostelium discoideum cDNA clone:ddv41c04, 5' ... 54 5e-11 3
(BJ338004) Dictyostelium discoideum cDNA clone:dda59b23, 5' ... 54 6e-11 3
(BJ397198) Dictyostelium discoideum cDNA clone:dds45m11, 5' ... 54 6e-11 3
(BJ427228) Dictyostelium discoideum cDNA clone:ddv61a20, 5' ... 54 6e-11 3
(EF650311) Tillobroma punctipennis alanyl-tRNA synthetase (A... 76 7e-11 2
(DV091451) 327-384-43_I16_M13-FP Nematostella vectensis norm... 54 8e-11 2
(EF650318) Damalis monochaetes alanyl-tRNA synthetase (AATS)... 54 8e-11 2
(EK241913) 1095460228545 Global-Ocean-Sampling_GS-31-01-01-1... 46 1e-10 4
(EF650282) Diogmites grossus alanyl-tRNA synthetase (AATS) g... 80 2e-10 1
(FI793939) SIR-19I15TF Sisymbrium irio BAC library SIR Sisym... 80 2e-10 1
(GE545543) CCHS4492.b1_G20.ab1 CCHS Espina Barnadesia spinos... 80 2e-10 1
(EU436053) Ortalischema albitarse voucher su31 alanyl-tRNA s... 70 2e-10 2
(EU436050) Microsepsis armillata voucher su28 alanyl-tRNA sy... 76 3e-10 2
(EF650271) Neolophonotus bimaculatus alanyl-tRNA synthetase ... 72 3e-10 2
(EF650274) Proctacanthus philadelphicus alanyl-tRNA syntheta... 66 3e-10 2
(EL602584) He_pwd_0205G05_M13R Heliconius erato pooled wing ... 54 3e-10 3
(FG521107) 030702KAZB009869HT (KAZB) Actinidia chinensis you... 68 3e-10 2
(AM505060) Paracentrotus lividus EST, clone MPMGp1171P073Q, ... 64 3e-10 2
(AM507962) Paracentrotus lividus EST, clone MPMGp1171B0317Q,... 64 4e-10 2
(AM508849) Paracentrotus lividus EST, clone MPMGp1171K1423Q,... 64 4e-10 2
(AM522221) Paracentrotus lividus EST, clone MPMGp1171I2222Q,... 64 4e-10 2
(EF650283) Lestomyia fraudiger alanyl-tRNA synthetase (AATS)... 52 4e-10 3
(BX842632) Neurospora crassa DNA linkage group I BAC contig ... 74 6e-10 2
(EF650308) Prolepsis tristis alanyl-tRNA synthetase (AATS) g... 50 6e-10 3
(BJ425146) Dictyostelium discoideum cDNA clone:ddv54d22, 5' ... 50 6e-10 3
(EU436032) Archisepsis pleuralis voucher su9 alanyl-tRNA syn... 78 8e-10 1
(DQ048406) Pan troglodytes AARS gene, VIRTUAL TRANSCRIPT, pa... 66 1e-09 3
(BJ562700) Ipomoea nil cDNA clone:jm37l07, 5' end, single read. 60 1e-09 2
(CJ750557) Ipomoea nil cDNA clone:jmsf50b10, 5' end. 60 1e-09 2
(AM514673) Paracentrotus lividus EST, clone MPMGp1171P0719Q,... 62 1e-09 2
(EY847270) CA26-C1-002-067-A04-CT.F Sour orange leaf, field ... 76 2e-09 2
(EK098920) 1092962061505 Global-Ocean-Sampling_GS-31-01-01-1... 72 2e-09 2
(EF650300) Emphysomera pallidapex alanyl-tRNA synthetase (AA... 76 3e-09 1
(CR769524) Pongo abelii mRNA; EST DKFZp469N0829_r1 (from clo... 76 3e-09 1
(CP000941) Xylella fastidiosa M12, complete genome. 76 3e-09 1
(EF650264) Bombylius major alanyl-tRNA synthetase (AATS) gen... 66 4e-09 2
(EU436034) Archisepsis scabra voucher su11 alanyl-tRNA synth... 48 4e-09 2
(DB891525) Populus nigra mRNA, clone: PnFL2-095_P09, 5'end. 62 4e-09 2
(CX174114) G03_69-74_13.ab1 leaf inoculated with Marssonia p... 62 5e-09 2
(DN312686) PL06013B1D12 cDNA from juvenile hermaphodites Sch... 46 6e-09 4
(DU099733) JBnY022G19F Brassica napus BAC library JBnY Brass... 72 6e-09 2
(DU103339) JBnY022G20F Brassica napus BAC library JBnY Brass... 72 6e-09 2
(FE849031) CAFO1831.fwd CAFO Pichia stipitis aerobic xylose ... 58 7e-09 4
(FE844386) CAFH387.fwd CAFH Pichia stipitis aerobic dextrose... 58 7e-09 4
(FE854364) CAFT1076.fwd CAFT Pichia stipitis oxygen limited ... 58 7e-09 4
(FE843683) CAFH1456.fwd CAFH Pichia stipitis aerobic dextros... 58 8e-09 4
(FE854431) CAFT1111.fwd CAFT Pichia stipitis oxygen limited ... 58 8e-09 4
(CP000584) Ostreococcus lucimarinus CCE9901 chromosome 4, co... 74 1e-08 1
(EU436030) Archisepsis diversiformis voucher su7 alanyl-tRNA... 74 1e-08 1
(DW489173) GH_RMIRS_073_F03_R Cotton Normalized Library rand... 74 1e-08 1
(DW489172) GH_RMIRS_073_F03_F Cotton Normalized Library rand... 74 1e-08 1
(DW148198) CLVX13226.b1_D19.ab1 CLV(XYZ) lettuce virosa Lact... 74 1e-08 1
(DW148140) CLVX13172.b1_H05.ab1 CLV(XYZ) lettuce virosa Lact... 74 1e-08 1
(DW085602) CLPX8674.b1_C10.ab1 CLP(XYZ) lettuce perennis Lac... 74 1e-08 1
(DW082334) CLPX5154.b1_D17.ab1 CLP(XYZ) lettuce perennis Lac... 74 1e-08 1
(CD524119) ku96c09.y1 Strongyloides ratti PA female naive pA... 74 1e-08 1
(GH106057) G993P133RL13.T0 Neurospora crassa cDNA - 1 hour G... 74 1e-08 1
(GE938699) G1176P133RP20.T0 Neurospora crassa cDNA - 1 hour ... 74 1e-08 1
(FF329328) 280439790 Pea aphid whole body normalized full le... 74 1e-08 1
(FF320343) 280407743 Pea aphid whole body normalized full le... 74 1e-08 1
(FF317626) 280393364 Pea aphid whole body normalized full le... 74 1e-08 1
(FF312747) 279385561 Pea aphid whole body normalized full le... 74 1e-08 1
(FF295136) 279304728 Pea aphid whole body normalized full le... 74 1e-08 1
(EX649881) 256735934 Pea aphid whole body normalized full le... 74 1e-08 1
(EX648419) 256721676 Pea aphid whole body normalized full le... 74 1e-08 1
(EX639914) 256631207 Pea aphid whole body normalized full le... 74 1e-08 1
(EX637333) 256614881 Pea aphid whole body normalized full le... 74 1e-08 1
(EX626015) 255434375 Pea aphid whole body normalized full le... 74 1e-08 1
(EX622954) 255422642 Pea aphid whole body normalized full le... 74 1e-08 1
(EX612498) 255379665 Pea aphid whole body normalized full le... 74 1e-08 1
(EX610508) 255371893 Pea aphid whole body normalized full le... 74 1e-08 1
(AE003849) Xylella fastidiosa 9a5c, complete genome. 74 1e-08 1
(ES228145) T01172_J07_C1C2_E07_012 CC - Norway Spruce Subtra... 66 1e-08 2
(EU436085) Zuskamira inexpectata voucher su75 alanyl-tRNA sy... 70 1e-08 2
(EF650277) Dysmachus trigonus alanyl-tRNA synthetase (AATS) ... 64 1e-08 2
(EJ078905) 1095458144962 Global-Ocean-Sampling_GS-26-01-01-1... 54 2e-08 2
(CN952301) Ha_mx0_58d02_SP6 Lobster Multiple Tissues, Normal... 72 2e-08 2
(EK314434) 1095462408118 Global-Ocean-Sampling_GS-31-01-01-1... 46 2e-08 3
(FG496481) 030414KAWC007674HT (KAWC) Actinidia chinensis - a... 68 2e-08 2
(CU466930) Candidatus Cloacamonas acidaminovorans provisiona... 58 5e-08 2
(EH116683) HA_MX0_95g05_SP6 Lobster Multiple Tissues, Normal... 72 5e-08 1
(GE484530) CCFS1587.b1_E13.ab1 CCF(STU) sunflower Helianthus... 72 5e-08 1
(BJ558889) Ipomoea nil cDNA clone:jm26p13, 5' end, single read. 54 5e-08 2
(EL506625) B06_PF-SAU3A-T3-M-P25_D.AB1 Blood stage Plasmodiu... 58 5e-08 2
(EL506624) B06_PF-SAU3A-T3-M-P25.AB1 Blood stage Plasmodium ... 58 5e-08 2
(GO725500) 010709OTYA022074HT OTYA Ovis aries cDNA 5', mRNA ... 60 6e-08 2
(DQ048405) Homo sapiens AARS gene, VIRTUAL TRANSCRIPT, parti... 58 6e-08 3
(DQ894824) Synthetic construct Homo sapiens clone IMAGE:1000... 58 6e-08 3
(DQ891634) Synthetic construct clone IMAGE:100004264; FLH178... 58 6e-08 3
(AM521760) Paracentrotus lividus EST, clone MPMGp1171L0911Q,... 56 7e-08 2
(BC011451) Homo sapiens alanyl-tRNA synthetase, mRNA (cDNA c... 58 7e-08 3
(AK299098) Homo sapiens cDNA FLJ61339 complete cds, highly s... 58 7e-08 3
(DT663696) He_wd2a1_95B07_M13R Heliconius erato wing disk 2 ... 54 7e-08 2
(CQ725247) Sequence 11181 from Patent WO02068579. 58 7e-08 3
(GN089244) Sequence 7 from Patent WO2009032915. 58 7e-08 3
(GC694681) Sequence 4054 from patent US 6812339. 58 7e-08 3
(AK222824) Homo sapiens mRNA for alanyl-tRNA synthetase vari... 58 7e-08 3
(AM515276) Paracentrotus lividus EST, clone MPMGp1171G0927Q,... 56 7e-08 2
(AM540949) Paracentrotus lividus EST, clone MPMGp1171J2271Q,... 56 8e-08 2
(EL393877) CFFM5335.b1_N14.ab1 CFF(LMS) safflower Carthamus ... 62 8e-08 2
(AR454590) Sequence 63 from patent US 6682888. 58 8e-08 3
(AM516764) Paracentrotus lividus EST, clone MPMGp1171G1535Q,... 56 8e-08 2
(AM504484) Paracentrotus lividus EST, clone MPMGp1171J221Q, ... 56 8e-08 2
(EE821703) 020605ONLN145086HT ONLN Ovis aries cDNA, mRNA seq... 60 9e-08 2
(ER574841) 1093015809473 Global-Ocean-Sampling_GS-36-01-01-2... 42 1e-07 4
(AC148538) Pan troglodytes clone CH251-167M3, WORKING DRAFT ... 66 2e-07 3
(AC186000) Pan troglodytes BAC clone CH251-167M3 from chromo... 66 2e-07 3
(EH008455) PIC-B-1770 Sus Scrofa Adipocyte Zap Express Libra... 50 2e-07 3
(BP461495) Sus scrofa mRNA, clone:OVRM10196H02, 5' end, expr... 50 2e-07 3
(BJ704025) Ptyochromis sp. 'redtail sheller' cDNA clone:no57... 62 2e-07 2
(CP000655) Polynucleobacter necessarius subsp. asymbioticus ... 58 2e-07 2
(CP000497) Pichia stipitis CBS 6054 chromosome 3, complete s... 58 2e-07 2
(BP146106) Sus scrofa mRNA, clone:OVRM10108A12, 5' end, expr... 50 2e-07 3
(ER443681) 1092963822667 Global-Ocean-Sampling_GS-35-01-01-1... 70 2e-07 1
(EB592761) AGENCOURT_51880091 D. ananassae EST Drosophila an... 70 2e-07 1
(CX532855) s13dNF75G11MJ084_271992 Methyl Jasmonate-Elicited... 70 2e-07 1
(CX529287) s13dNF18F07MJ059_244632 Methyl Jasmonate-Elicited... 70 2e-07 1
(CR853430) Pongo abelii mRNA; EST DKFZp469G137_r1 (from clon... 70 2e-07 1
(CB894828) EST647620 HOGA Medicago truncatula cDNA clone HOG... 70 2e-07 1
(BG453786) NF094A07LF1F1050 Developing leaf Medicago truncat... 70 2e-07 1
(BG448365) NF024C05EC1F1035 Elicited cell culture Medicago t... 70 2e-07 1
(BF648615) NF048B01EC1F1011 Elicited cell culture Medicago t... 70 2e-07 1
(GE929678) G1176P124RF22.T0 Neurospora crassa cDNA - 1 hour ... 70 2e-07 1
(AC115598) Dictyostelium discoideum chromosome 2 map 581427-... 54 2e-07 2
(BP458393) Sus scrofa mRNA, clone:OVRM10153D12, 5' end, expr... 50 2e-07 3
(DN443528) LIB5338-108-A1-K2-D4 LIB5338 Canis lupus familiar... 58 2e-07 2
(EF650280) Tolmerus atricapillus alanyl-tRNA synthetase (AAT... 62 2e-07 2
(EX654888) A_BS-P5-3-H01.ab1 Full-length enriched cDNA from ... 50 2e-07 3
(EX655386) A_BS-P5-9-H07.ab1 Full-length enriched cDNA from ... 50 2e-07 3
(BP282100) Homo sapiens cDNA clone: KMR03273, Sugano cDNA li... 58 2e-07 2
(ER500387) 1093015396748 Global-Ocean-Sampling_GS-35-01-01-1... 60 2e-07 2
(EU436049) Meroplius fukuharai voucher su26 alanyl-tRNA synt... 60 2e-07 2
(DN375632) LIB38529_012_C06_T7_1 LIB38529 Canis lupus famili... 58 2e-07 2
(CN277048) 17000531864156 GRN_EB Homo sapiens cDNA 5', mRNA ... 58 2e-07 2
(DN424095) LIB4216-087-Q1-K1-G3 LIB4216 Canis lupus familiar... 58 2e-07 2
(CN277035) 17000533312418 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 2e-07 2
(BP281787) Homo sapiens cDNA clone: KMR02383, Sugano cDNA li... 58 2e-07 2
(BM834619) K-EST0109627 S11SNU1 Homo sapiens cDNA clone S11S... 58 2e-07 2
(CN277061) 17000532204340 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 2e-07 2
(CN277040) 17000531878272 GRN_EB Homo sapiens cDNA 5', mRNA ... 58 2e-07 2
(CN277051) 17000532613534 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 2e-07 2
(FD624361) susfleck_FC_9_E05 SUSFLECK Fat Cell Sus scrofa cD... 50 3e-07 3
(BE888227) 601511747F1 NIH_MGC_71 Homo sapiens cDNA clone IM... 58 3e-07 2
(BE728330) 601561719F1 NIH_MGC_20 Homo sapiens cDNA clone IM... 58 3e-07 2
(BE387386) 601274465F1 NIH_MGC_20 Homo sapiens cDNA clone IM... 58 3e-07 2
(BP445389) Sus scrofa mRNA, clone:LVR010054E12, 5' end, expr... 50 3e-07 3
(CR984614) RZPD Homo sapiens cDNA expression clone RZPDp9016... 58 3e-07 2
(DB858085) Lipochromis sp. 'matumbi hunter' cDNA clone:hm701... 62 3e-07 2
(BP141942) Sus scrofa mRNA, clone:OVR010003B08, 5' end, expr... 50 3e-07 3
(CN277062) 17000531390060 GRN_EB Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(CN277037) 17000533183280 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(BE892655) 601433466F1 NIH_MGC_72 Homo sapiens cDNA clone IM... 58 3e-07 2
(DR005620) TC119146 Human prostate, large insert, pCMV expre... 58 3e-07 2
(BE407232) 601301350F1 NIH_MGC_21 Homo sapiens cDNA clone IM... 58 3e-07 2
(BG746616) 602703924F1 NIH_MGC_15 Homo sapiens cDNA clone IM... 58 3e-07 2
(CN277058) 17000424715792 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(BG393096) 602411364F1 NIH_MGC_92 Homo sapiens cDNA clone IM... 58 3e-07 2
(CN277033) 17000531860390 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(CN277046) 17000424345637 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(BF794496) 602255742F1 NIH_MGC_85 Homo sapiens cDNA clone IM... 58 3e-07 2
(AC216770) Populus trichocarpa clone POP051-A24, complete se... 62 3e-07 5
(CJ437203) Macaca fascicularis mRNA, clone: QccE-14356, 5' e... 58 3e-07 2
(BW983456) Sus scrofa mRNA, clone:ITT010084C09, 5' end, expr... 50 3e-07 3
(CX873007) HESC4_75_F11.g1_A037 NIH_MGC_262 Homo sapiens cDN... 58 3e-07 2
(CN277050) 17000470834309 GRN_EB Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(CN277054) 17000418252554 GRN_ES Homo sapiens cDNA 5', mRNA ... 58 3e-07 2
(CJ460791) Macaca fascicularis mRNA, clone: QmoA-13601, 5' e... 58 3e-07 2
(ER484180) 1093015286829 Global-Ocean-Sampling_GS-35-01-01-1... 44 3e-07 3
(CV813059) AGENCOURT_36377475 NIH_MGC_280 Homo sapiens cDNA ... 58 3e-07 2
(ER291624) 1092343606702 Global-Ocean-Sampling_GS-34-01-01-1... 54 3e-07 2
(BF796250) 602258542F1 NIH_MGC_85 Homo sapiens cDNA clone IM... 58 3e-07 2
(CX166708) HESC2_43_F10.g1_A035 NIH_MGC_258 Homo sapiens cDN... 58 3e-07 2
(AU143575) Homo sapiens cDNA clone:Y79AA1002151, 5' end, exp... 58 3e-07 2
(DA729968) Homo sapiens cDNA clone NT2RM2004200, 5' end, mRN... 58 3e-07 2
(AU133772) Homo sapiens cDNA clone:OVARC1000630, 5' end, exp... 58 3e-07 2
(DN877952) nae17e02.y1 Dog eye eye minus lens and cornea. Un... 58 3e-07 2
(CJ480864) Macaca fascicularis mRNA, clone: QtrA-16432, 5' e... 58 3e-07 2
(BU543395) AGENCOURT_10327091 NIH_MGC_40 Homo sapiens cDNA c... 58 3e-07 2
(CO249356) AGENCOURT_26529120 NIH_MGC_212 Homo sapiens cDNA ... 58 3e-07 2
(EL512319) CHTX1045.b1_I22.ab1 CHT(XYZ) Jerusalem artichoke ... 64 3e-07 2
(CJ472026) Macaca fascicularis mRNA, clone: QorA-11766, 5' e... 58 3e-07 2
(CD653267) AGENCOURT_14541029 NIA Human H1 Embryonic Stem Ce... 58 3e-07 2
(BU509769) AGENCOURT_10170559 NIH_MGC_71 Homo sapiens cDNA c... 58 3e-07 2
(BU541172) AGENCOURT_10327459 NIH_MGC_40 Homo sapiens cDNA c... 58 3e-07 2
(GE584432) CCPU8776.b1_P10.ab1 CCP(UWX) Globe Artichoke Cyna... 58 3e-07 2
(CD657576) AGENCOURT_14537917 NIA Human H1 Embryonic Stem Ce... 58 3e-07 2
(BU856327) AGENCOURT_10472617 NIH_MGC_109 Homo sapiens cDNA ... 58 3e-07 2
(BG325796) 602424513F1 NIH_MGC_14 Homo sapiens cDNA clone IM... 58 3e-07 2
(BU542116) AGENCOURT_10252890 NIH_MGC_40 Homo sapiens cDNA c... 58 3e-07 2
(BU543182) AGENCOURT_10338621 NIH_MGC_40 Homo sapiens cDNA c... 58 3e-07 2
(BU543413) AGENCOURT_10327109 NIH_MGC_40 Homo sapiens cDNA c... 58 3e-07 2
(BU845565) AGENCOURT_10414149 NIH_MGC_109 Homo sapiens cDNA ... 58 3e-07 2
(CF551910) AGENCOURT_15595775 NIH_MGC_183 Homo sapiens cDNA ... 58 3e-07 2
(BU500380) AGENCOURT_7859849 NIH_MGC_64 Homo sapiens cDNA cl... 58 4e-07 2
(BU844930) AGENCOURT_10412243 NIH_MGC_109 Homo sapiens cDNA ... 58 4e-07 2
>(AF188717) Dictyostelium discoideum alanyl-tRNA synthetase (AlaS)
mRNA, complete cds.
Length = 2924
Score = 963 bits (486), Expect(5) = 0.0
Identities = 486/486 (100%)
Strand = Plus / Plus
Query: 77 agagagaaatatgaacatacatttgttccatcatcagcagtaattccacatgatgatcca 136
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77 agagagaaatatgaacatacatttgttccatcatcagcagtaattccacatgatgatcca 136
Query: 137 actttattatttgcaaatgcaggtatgaatcaatttaaaccaatctttttaggacaagtt 196
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 actttattatttgcaaatgcaggtatgaatcaatttaaaccaatctttttaggacaagtt 196
Query: 197 aatccaaaatcagaacaagcaaaattgaagagagcagtcaatagtcaaaaatgtattcgt 256
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 aatccaaaatcagaacaagcaaaattgaagagagcagtcaatagtcaaaaatgtattcgt 256
Query: 257 gcaggtggtaaacataatgatttggatgatgtaggtaaggatacttatcatcacaccttc 316
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 gcaggtggtaaacataatgatttggatgatgtaggtaaggatacttatcatcacaccttc 316
Query: 317 tttgagatgttgggtaattggtcatttggcaattactttaagaaggaggcaatcacttgg 376
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 317 tttgagatgttgggtaattggtcatttggcaattactttaagaaggaggcaatcacttgg 376
Query: 377 gcatgggaattattgacagaggtatacaaattagataaagaacgtttatatgtcacttac 436
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 gcatgggaattattgacagaggtatacaaattagataaagaacgtttatatgtcacttac 436
Query: 437 tttagaggtgacccagagaaaggattggaagcagatctcgaagcaaagaacctttggttg 496
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 437 tttagaggtgacccagagaaaggattggaagcagatctcgaagcaaagaacctttggttg 496
Query: 497 caatatttaccagaggaacgtgtgctcccattcggtatgaaagagaacttttgggagatg 556
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 497 caatatttaccagaggaacgtgtgctcccattcggtatgaaagagaacttttgggagatg 556
Query: 557 ggtgac 562
||||||
Sbjct: 557 ggtgac 562
Score = 543 bits (274), Expect(5) = 0.0
Identities = 274/274 (100%)
Strand = Plus / Plus
Query: 780 ttcaaactaaatcaccaatgactgcaatcatgttaattagtccagatgaagaaaaaggta 839
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2616 ttcaaactaaatcaccaatgactgcaatcatgttaattagtccagatgaagaaaaaggta 2675
Query: 840 aagttacttgcattggtatcgttccaaaagattctgaaatctcaaaaactttaactgcaa 899
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2676 aagttacttgcattggtatcgttccaaaagattctgaaatctcaaaaactttaactgcaa 2735
Query: 900 atgcttgggttgtaaaggttaccgaagttttaggtggtaaaggtggtggtaaagttgatg 959
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2736 atgcttgggttgtaaaggttaccgaagttttaggtggtaaaggtggtggtaaagttgatg 2795
Query: 960 ttgctcaaggtgttggttctaaattagataaaatcgatgaagctattctcgtttcaagag 1019
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2796 ttgctcaaggtgttggttctaaattagataaaatcgatgaagctattctcgtttcaagag 2855
Query: 1020 aatttgcaaatgcaaactgattcaaattatcttt 1053
||||||||||||||||||||||||||||||||||
Sbjct: 2856 aatttgcaaatgcaaactgattcaaattatcttt 2889
Score = 396 bits (200), Expect(5) = 0.0
Identities = 200/200 (100%)
Strand = Plus / Plus
Query: 573 ttcgtatgaatttggttgaaactttgaaggaagttcaagcactccaaagaaaacaagtca 632
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2409 ttcgtatgaatttggttgaaactttgaaggaagttcaagcactccaaagaaaacaagtca 2468
Query: 633 aagaacaagaaaccatcttggctcaacaagctcaaacctatttagagaaaacctctgaag 692
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2469 aagaacaagaaaccatcttggctcaacaagctcaaacctatttagagaaaacctctgaag 2528
Query: 693 aattggctaaatctcaaccaaaggttttcgtagatttagtaaacttcaattcaaatactc 752
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2529 aattggctaaatctcaaccaaaggttttcgtagatttagtaaacttcaattcaaatactc 2588
Query: 753 ctttaatcactgaaaccatt 772
||||||||||||||||||||
Sbjct: 2589 ctttaatcactgaaaccatt 2608
Score = 67.9 bits (34), Expect(5) = 0.0
Identities = 34/34 (100%)
Strand = Plus / Plus
Query: 36 tggatgttaatcaaattagaaaaacttttatcga 69
||||||||||||||||||||||||||||||||||
Sbjct: 36 tggatgttaatcaaattagaaaaacttttatcga 69
Score = 54.0 bits (27), Expect(5) = 0.0
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 1 ggaaggagatataaaatataaaagaag 27
|||||||||||||||||||||||||||
Sbjct: 1 ggaaggagatataaaatataaaagaag 27
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Number of Sequences: 105743758
Number of Hits to DB: 1,298,032,799
Number of extensions: 76167442
Number of successful extensions: 6156205
Number of sequences better than 10.0: 1474
Length of query: 1088
Length of database: 104,622,809,269
Length adjustment: 24
Effective length of query: 1064
Effective length of database: 102,084,959,077
Effective search space: 108618396457928
Effective search space used: 108618396457928
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)
Dictyostelium discoideum cDNA Project Home